Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1035 bp · LXL04_010930|LXL04_010930|OH1004|cDNA
ATGGGAGAACCTCCGAAGGGGACGGTGACATCGTTATCTTCAATATACTCACCAGAGGATTCCCAGAAAGCGTCTGTACGTGTCCAAGAAACGATCTCCGAACGTCAGAAAGAAGTTCAGCAGCTCCAAACCTTCCTCAATGACAACACAAACCTAGTCAATCTTGTTAAGAAGCTCCCCGATCAATTACACCACGATATAATGGCAAATCATCCACACCTAGACTCGTTTCTCATTTCATTAACGTTAATCTCAGTTCC...
1035 bp · LXL04_010930|LXL04_010930|OH1004|CDS
ATGGGAGAACCTCCGAAGGGGACGGTGACATCGTTATCTTCAATATACTCACCAGAGGATTCCCAGAAAGCGTCTGTACGTGTCCAAGAAACGATCTCCGAACGTCAGAAAGAAGTTCAGCAGCTCCAAACCTTCCTCAATGACAACACAAACCTAGTCAATCTTGTTAAGAAGCTCCCCGATCAATTACACCACGATATAATGGCAAATCATCCACACCTAGACTCGTTTCTCATTTCATTAACGTTAATCTCAGTTCC...
Protein
Download Protein FASTA344 aa · LXL04_010930|LXL04_010930|OH1004|PROTEIN
MGEPPKGTVTSLSSIYSPEDSQKASVRVQETISERQKEVQQLQTFLNDNTNLVNLVKKLPDQLHHDIMANHPHLDSFLISLTLISVPFGKAAFFPGKIIHTNEFLVLLGEGYYADRTSKQTIEILKRRGKDLESQIENLNAVIKDLKYEASFFIETATEAAEGVVEIREDYVDEFLDEEKEAPTEEEYSRILSRIDELEKEEMESEMAEEDEEKEEEEEEEKDKAELSDVLSRTHLEPKVISSEKHMGNEHLKSKESSNI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_010930 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_010930 |
|---|---|
| Location | Chr02:155268859-155270356 (-) |
| Description | Similar to rmp: RNA polymerase II subunit 5-mediating protein homolog |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0001558 regulation of cell growth Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0007283 spermatogenesis Biological Process GO:0009615 response to virus Biological Process GO:0010923 negative regulation of phosphatase activity Biological Process GO:0050821 protein stabilization Biological Process GO:0071363 cellular response to growth factor stimulus Biological Process GO:0071383 cellular response to steroid hormone stimulus Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component |
| KEGG gene cross-reference | bta:515119 ddi:DDB_G0289477 dme:Dmel_CG11416 hsa:8725 mmu:19777 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02996.23Prefoldin84-159 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_010930 | PF02996.23 | Prefoldin | 84 | 159 | 2.4e-19 | 70.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.