LXL04_010891 | RubberDandelionOmics

Gene overview

LXL04_010891

Reference: OH-1004 Chr: Chr02 Coordinates: 154946257-154948810 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1443 bp · LXL04_010891|LXL04_010891|OH1004|cDNA

ATGGAGGTTGAGGTAGCAGAAGAATCAATGGAGTTGAATAACAACGTCATGTGTCAATTAGCGGACCCAGAAGGAACGCCACTCGGTGCTTCCATATATCTTCCCCAAAGCGTTGGCCCCAAGGAGCTTCAACAGATGGTTAACAAGTTGCTCAACAATgAGGAAAGGCTACCATACGCCTTTTATATATCCGATCAAGAGCTTGTTATACAACTAGGAGATTATTTGCAGAAGAACAAAGTTTCTGTGGAGAAGGTAGT...

CDS

Download CDS FASTA

1443 bp · LXL04_010891|LXL04_010891|OH1004|CDS

ATGGAGGTTGAGGTAGCAGAAGAATCAATGGAGTTGAATAACAACGTCATGTGTCAATTAGCGGACCCAGAAGGAACGCCACTCGGTGCTTCCATATATCTTCCCCAAAGCGTTGGCCCCAAGGAGCTTCAACAGATGGTTAACAAGTTGCTCAACAATGAGGAAAGGCTACCATACGCCTTTTATATATCCGATCAAGAGCTTGTTATACAACTAGGAGATTATTTGCAGAAGAACAAAGTTTCTGTGGAGAAGGTAGT...

Protein

Download Protein FASTA

480 aa · LXL04_010891|LXL04_010891|OH1004|PROTEIN

MEVEVAEESMELNNNVMCQLADPEGTPLGASIYLPQSVGPKELQQMVNKLLNNEERLPYAFYISDQELVIQLGDYLQKNKVSVEKVVTIVYQPQAVFRIRPVSRCSSTIAGHTEAVLSVVFSPDGQQLASGSGDTTVRLWDLNTQTPLFTCTGHKNWVLCVAWSPDGKHLVSGSKSGEIQIWDPRTGKASGNLLTGHKKWITGISWEPVHLSSPCRRFVTASKDGDARIWDATLRKTVIILSGHTLAVTCVKWGGDGVIY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010891`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010891

Location Chr02:154946257-154948810 (+)

Description Similar to NLE1: Notchless protein homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g52820`	Required for female gametophyte development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010891 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000027 ribosomal large subunit assembly Biological Process

GO:0007219 Notch signaling pathway Biological Process

GO:0008593 regulation of Notch signaling pathway Biological Process

GO:0009553 embryo sac development Biological Process

GO:0042273 ribosomal large subunit biogenesis Biological Process

GO:0045930 negative regulation of mitotic cell cycle Biological Process

GO:0061484 hematopoietic stem cell homeostasis Biological Process

GO:0090263 positive regulation of canonical Wnt signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0080008 Cul4-RING E3 ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT5G52820

hsa:54475

mmu:217011

pon:100171489

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.522

Rank 1 · LXL04_010891 · OH-1004

Nucleus0.427

Rank 2 · LXL04_010891 · OH-1004

Cell membrane0.082

Rank 3 · LXL04_010891 · OH-1004

Endoplasmic reticulum0.052

Rank 4 · LXL04_010891 · OH-1004

Mitochondrion0.051

Rank 5 · LXL04_010891 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08154.19NLE16-76 aa

PF25460.2Beta-prop_Aladin97-186 aa

PF25172.2Beta-prop_WDR3_2nd103-144 aa

PF25175.2Beta-prop_WDR5104-232 aa

PF00400.39WD40104-141 aa

PF25174.2Beta-prop_THOC3104-158 aa

PF24807.2WD40_CDC20-Fz104-169 aa

PF24814.2WD40_Prp19104-145 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010891	`PF08154.19`	NLE	16	76	1.3e-13	51.9
LXL04_010891	`PF25460.2`	Beta-prop_Aladin	97	186	4.9e-23	82.5
LXL04_010891	`PF25172.2`	Beta-prop_WDR3_2nd	103	144	1.4e-40	140.1
LXL04_010891	`PF25175.2`	Beta-prop_WDR5	104	232	2.5e-76	257.5
LXL04_010891	`PF00400.39`	WD40	104	141	8.7e-76	247.9
LXL04_010891	`PF25174.2`	Beta-prop_THOC3	104	158	3.3e-75	253.3
LXL04_010891	`PF24807.2`	WD40_CDC20-Fz	104	169	7.8e-63	213.2
LXL04_010891	`PF24814.2`	WD40_Prp19	104	145	2.8e-52	178.2
LXL04_010891	`PF25047.1`	Beta-prop_TEP1_2nd	104	204	1.1e-41	143.4
LXL04_010891	`PF24782.3`	WD40_MABP1-WDR62_2nd	104	142	7.6e-24	85.0
LXL04_010891	`PF23756.2`	Beta-prop_HPS5	104	191	1.2e-06	28.7
LXL04_010891	`PF23381.2`	Beta-prop_IFT122_1st	105	208	1.6e-75	254.7
LXL04_010891	`PF25173.2`	Beta-prop_WDR3_1st	105	205	4.6e-67	226.0
LXL04_010891	`PF24817.2`	WD40_WDHD1_1st	105	150	4.8e-44	151.4
LXL04_010891	`PF25391.2`	WD40_Gbeta	106	272	3.2e-40	138.9
LXL04_010891	`PF25171.2`	Beta-prop_WDR36-Utp21_1st	106	206	3.6e-18	66.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLX9`	Arabidopsis thaliana	Notchless protein homolog	80.942%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card