LXL04_010867 | RubberDandelionOmics

Gene overview

LXL04_010867

Reference: OH-1004 Chr: Chr02 Coordinates: 154477723-154482410 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2202 bp · LXL04_010867|LXL04_010867|OH1004|cDNA

ATGCATTCTCACGAATCCAAAATCTCGGTCCACAATGAGACACTCAGTGGCATATCCGTCGCACCACCATTAGCGATGGATTTGGCCGTCGtacCAGTTGACGTGAGTCTCCGCTTCTCCATTGACTTCCTAATTCTATGGTCTCCATGTGCATATAATGAGGTTTTCAATTTTCTTTATTCGTCACATTATCAAACAATGTGGATCACCTCCTGCAACGTTATCATTTCAGTGACCATGCTGATGATGCTTCCTTTCAT...

CDS

Download CDS FASTA

2202 bp · LXL04_010867|LXL04_010867|OH1004|CDS

ATGCATTCTCACGAATCCAAAATCTCGGTCCACAATGAGACACTCAGTGGCATATCCGTCGCACCACCATTAGCGATGGATTTGGCCGTCGTACCAGTTGACGTGAGTCTCCGCTTCTCCATTGACTTCCTAATTCTATGGTCTCCATGTGCATATAATGAGGTTTTCAATTTTCTTTATTCGTCACATTATCAAACAATGTGGATCACCTCCTGCAACGTTATCATTTCAGTGACCATGCTGATGATGCTTCCTTTCAT...

Protein

Download Protein FASTA

733 aa · LXL04_010867|LXL04_010867|OH1004|PROTEIN

MHSHESKISVHNETLSGISVAPPLAMDLAVVPVDVSLRFSIDFLILWSPCAYNEVFNFLYSSHYQTMWITSCNVIISVTMLMMLPFMLVAACPTSYFGPYCWIDFTCINGSVVEVFIYNCDAFELQNVTFSSFPSLKRLSISTSNLEGNILHQIGLLQNLTYLDLSANYLSGTIPSQLWNLKNLQFLDLSQNLLSGPIPPSFASMINLTYLDLSINQLNGSIPKELRNLIYLKTLNLGDNLFRGLVPSVLGLLTQLEFLN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010867`
TK1151 ID	TkA03G552240
OH-1004 ID	LXL04_010867
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 17.735 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010867

Location Chr02:154477723-154482410 (-)

Description Similar to MIK2: MDIS1-interacting receptor like kinase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g08850`	Acts as a receptor of SCOOP peptides from Brassicaceae plants regulating multiple processing including plant growth, development and stress responses.	A receptor heteromer mediates the male perception of female attractants in plants.2016 · DOI: 10.1038/nature16975 Perception of a divergent family of phytocytokines by the Arabidopsis receptor kinase MIK2.2021 · DOI: 10.1038/s41467-021-20932-y The Arabidopsis MIK2 receptor elicits immunity by sensing a conserved signature from phytocytokines and microbes.2021 · DOI: 10.1038/s41467-021-25580-w The MIK2/SCOOP Signaling System Contributes to Arabidopsis Resistance Against Herbivory by Modulating Jasmonate and Indole Glucosinolate Biosynthesis.2022 · DOI: 10.3389/fpls.2022.852808
`At1g35710`	Probable leucine-rich repeat receptor-like protein kinase At1g35710.	No verified direct reference in this release
`At1g17230`	Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230.	No verified direct reference in this release
`At5g63930`	Probable leucine-rich repeat receptor-like protein kinase At5g63930.	No verified direct reference in this release
`At2g33170`	Probable leucine-rich repeat receptor-like protein kinase At2g33170.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010867 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002213 defense response to insect Biological Process

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0009695 jasmonic acid biosynthetic process Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009759 indole glucosinolate biosynthetic process Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0031349 positive regulation of defense response Biological Process

GO:0080027 response to herbivore Biological Process

GO:1901653 cellular response to peptide Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0090406 pollen tube Cellular Component

KEGG gene cross-reference

ath:AT4G08850

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.716

Rank 1 · LXL04_010867 · OH-1004

Endoplasmic reticulum0.117

Rank 2 · LXL04_010867 · OH-1004

Lysosome / Vacuole0.089

Rank 3 · LXL04_010867 · OH-1004

Cytoplasm0.079

Rank 4 · LXL04_010867 · OH-1004

Nucleus0.047

Rank 5 · LXL04_010867 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23598.2LRR_14128-213 aa

PF13855.13LRR_8134-194 aa

PF12799.14LRR_4158-194 aa

PF13855.13LRR_8159-218 aa

PF23598.2LRR_14204-311 aa

PF13855.13LRR_8207-266 aa

PF13855.13LRR_8277-314 aa

PF07714.24PK_Tyr_Ser-Thr467-731 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010867	`PF23598.2`	LRR_14	128	213	4.6e-14	52.6
LXL04_010867	`PF13855.13`	LRR_8	134	194	2.3e-20	72.8
LXL04_010867	`PF12799.14`	LRR_4	158	194	1.2e-18	67.3
LXL04_010867	`PF13855.13`	LRR_8	159	218	2.3e-20	72.8
LXL04_010867	`PF23598.2`	LRR_14	204	311	4.6e-14	52.6
LXL04_010867	`PF13855.13`	LRR_8	207	266	2.3e-20	72.8
LXL04_010867	`PF13855.13`	LRR_8	277	314	2.3e-20	72.8
LXL04_010867	`PF07714.24`	PK_Tyr_Ser-Thr	467	731	8e-41	140.8
LXL04_010867	`PF00069.32`	Pkinase	468	728	3.5e-45	155.2
LXL04_010867	`PF17667.8`	Pkinase_fungal	583	642	3.3e-06	26.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZG8`	Arabidopsis thaliana	MDIS1-interacting receptor like kinase 2	40.545%	Swiss-Prot	moderate database homology
`Q9LP24`	Arabidopsis thaliana	Probable leucine-rich repeat receptor-like protein kinase At1g35710	38.485%	Swiss-Prot	moderate database homology
`Q9SHI2`	Arabidopsis thaliana	Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230	36.834%	Swiss-Prot	moderate database homology
`Q9LVP0`	Arabidopsis thaliana	Probable leucine-rich repeat receptor-like protein kinase At5g63930	36.520%	Swiss-Prot	moderate database homology
`O49318`	Arabidopsis thaliana	Probable leucine-rich repeat receptor-like protein kinase At2g33170	34.930%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card