LXL04_010696 | RubberDandelionOmics

Gene overview

LXL04_010696

Reference: OH-1004 Chr: Chr02 Coordinates: 151777267-151779310 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

978 bp · LXL04_010696|LXL04_010696|OH1004|cDNA

ATGCTGGATTACACCAATGAAGTTTTTGAATGTGTTTTATTAATCGTTGCTAATTTATGTAGATACAATCAAGTCCATTTCAGTGGACTTTTGATGGACCAGTATGAGAAGGTTGAGAAGATTGGTGAAGGAACATATGGTGTAGTCTACAAGGCTCGTGACAAAATCACCAATGAAACTATTGCTTTAAAGAAGATTCGCCTCGAGCAAGAAGATGAAGGAGTACCAAGCACAGCTATTAGAGAGATCTCACTCCTGAA...

CDS

Download CDS FASTA

978 bp · LXL04_010696|LXL04_010696|OH1004|CDS

ATGCTGGATTACACCAATGAAGTTTTTGAATGTGTTTTATTAATCGTTGCTAATTTATGTAGATACAATCAAGTCCATTTCAGTGGACTTTTGATGGACCAGTATGAGAAGGTTGAGAAGATTGGTGAAGGAACATATGGTGTAGTCTACAAGGCTCGTGACAAAATCACCAATGAAACTATTGCTTTAAAGAAGATTCGCCTCGAGCAAGAAGATGAAGGAGTACCAAGCACAGCTATTAGAGAGATCTCACTCCTGAA...

Protein

Download Protein FASTA

325 aa · LXL04_010696|LXL04_010696|OH1004|PROTEIN

MLDYTNEVFECVLLIVANLCRYNQVHFSGLLMDQYEKVEKIGEGTYGVVYKARDKITNETIALKKIRLEQEDEGVPSTAIREISLLKEMQHGNIVRLQDVVHSDKRLYLVFEYLDLDLKKHMDSCPEFSKDPRLVKTFLYQILRGIAYCHSHRVLHRDLKPQNLLIDRRTNALKLADFGLARAFGIPVRTFTHEVVTLWYRAPEILLGSRHYSTPVDVWSVGCIFAEMVNQRPLFPGDSEIDELFKIFRIMGTPNEDTWP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010696`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_010696`
Location	Chr02:151777267-151779310 (-)
Description	Similar to CDC2A: Cell division control protein 2 homolog A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_010696` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000082 G1/S transition of mitotic cell cycle Biological Process GO:0007165 signal transduction Biological Process GO:0010389 regulation of G2/M transition of mitotic cell cycle Biological Process GO:0010468 regulation of gene expression Biological Process GO:0051301 cell division Biological Process GO:0051445 regulation of meiotic cell cycle Biological Process GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0004693 cyclin-dependent protein serine/threonine kinase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0008353 RNA polymerase II CTD heptapeptide repeat kinase activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.591

Rank 1 · LXL04_010696 · OH-1004

Nucleus0.563

Rank 2 · LXL04_010696 · OH-1004

Cell membrane0.061

Rank 3 · LXL04_010696 · OH-1004

Mitochondrion0.054

Rank 4 · LXL04_010696 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_010696 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase35-318 aa

PF07714.24PK_Tyr_Ser-Thr37-230 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010696	`PF00069.32`	Pkinase	35	318	2e-78	264.1
LXL04_010696	`PF07714.24`	PK_Tyr_Ser-Thr	37	230	3e-32	112.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card