LXL04_010635 | RubberDandelionOmics

Gene overview

LXL04_010635

Reference: OH-1004 Chr: Chr02 Coordinates: 150199672-150200779 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1020 bp · LXL04_010635|LXL04_010635|OH1004|cDNA

ATGGAAGATTCAGCTCAGAATTTGGTTAGATTTACTGGTGAAGAATTCAAGATGGATCCAGTCACTGCTCATGGTCGTCATCTACCTCCTCCTTTTCACGCAAGAGATCTCCAGTTGCACCACCACCAGCAGCTTCAGCAACACCATTCCCACCAccagcaacagcaacaacaacaccaccaccaccaccacaacaacaaccaacagCAGCCGAATTCCGAGGAGGACGAGCTAAGTGGCGGAAGCAGCAACCTCAACCA...

CDS

Download CDS FASTA

1020 bp · LXL04_010635|LXL04_010635|OH1004|CDS

ATGGAAGATTCAGCTCAGAATTTGGTTAGATTTACTGGTGAAGAATTCAAGATGGATCCAGTCACTGCTCATGGTCGTCATCTACCTCCTCCTTTTCACGCAAGAGATCTCCAGTTGCACCACCACCAGCAGCTTCAGCAACACCATTCCCACCACCAGCAACAGCAACAACAACACCACCACCACCACCACAACAACAACCAACAGCAGCCGAATTCCGAGGAGGACGAGCTAAGTGGCGGAAGCAGCAACCTCAACCA...

Protein

Download Protein FASTA

339 aa · LXL04_010635|LXL04_010635|OH1004|PROTEIN

MEDSAQNLVRFTGEEFKMDPVTAHGRHLPPPFHARDLQLHHHQQLQQHHSHHQQQQQQHHHHHHNNNQQQPNSEEDELSGGSSNLNHGQKREREDTHNNNNDGNRELASVVTGGEGDHSSGGGSGGSRRPRGRPAGSKNKPKPPIIITRDSANALRSHVMEVANGCDIQESISNFATRKQRGVCILSGSGTVTNVTLKQPAAPGAVVTLHGRFEILSLSGSFLPPPAPPAASGLTIYLAGGQGQVVGGGVVGPLLASGPV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010635`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010635

Location Chr02:150199672-150200779 (-)

Description Similar to AHL18: AT-hook motif nuclear-localized protein 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60870`	Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity).	Over-expression of an AT-hook gene, AHL22, delays flowering and inhibits the elongation of the hypocotyl in Arabidopsis thaliana.2009 · DOI: 10.1007/s11103-009-9507-9
`At2g45430`	Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).	Over-expression of an AT-hook gene, AHL22, delays flowering and inhibits the elongation of the hypocotyl in Arabidopsis thaliana.2009 · DOI: 10.1007/s11103-009-9507-9 The AT-hook motif-containing protein AHL22 regulates flowering initiation by modifying FLOWERING LOCUS T chromatin in Arabidopsis.2012 · DOI: 10.1074/jbc.m111.318477
`At4g22810`	Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).	No verified direct reference in this release
`At4g12050`	Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).	No verified direct reference in this release
`At2g42940`	Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010635 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009647 skotomorphogenesis Biological Process

GO:0009908 flower development Biological Process

GO:0010208 pollen wall assembly Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0048364 root development Biological Process

GO:0141005 transposable element silencing by heterochromatin formation Biological Process

GO:0005634 nucleus Cellular Component

GO:0003680 minor groove of adenine-thymine-rich DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT2G42940

ath:AT2G45430

ath:AT3G60870

ath:AT4G12050

ath:AT4G22810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · LXL04_010635 · OH-1004

Cytoplasm0.092

Rank 2 · LXL04_010635 · OH-1004

Cell membrane0.028

Rank 3 · LXL04_010635 · OH-1004

Endoplasmic reticulum0.018

Rank 4 · LXL04_010635 · OH-1004

Plastid0.010

Rank 5 · LXL04_010635 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03479.22PCC150-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010635	`PF03479.22`	PCC	150	267	1.5e-33	116.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZX7`	Arabidopsis thaliana	AT-hook motif nuclear-localized protein 18	56.940%	Swiss-Prot	strong database homology
`O22130`	Arabidopsis thaliana	AT-hook motif nuclear-localized protein 22	70.996%	Swiss-Prot	moderate database homology
`O49662`	Arabidopsis thaliana	AT-hook motif nuclear-localized protein 24	55.752%	Swiss-Prot	strong database homology
`Q9SZ70`	Arabidopsis thaliana	AT-hook motif nuclear-localized protein 26	57.391%	Swiss-Prot	strong database homology
`Q9SJG4`	Arabidopsis thaliana	AT-hook motif nuclear-localized protein 16	60.952%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card