LXL04_010026 | RubberDandelionOmics

Gene overview

LXL04_010026

Reference: OH-1004 Chr: Chr02 Coordinates: 138343547-138344443 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

897 bp · LXL04_010026|LXL04_010026|OH1004|cDNA

ATGTTCCTTTGTGGTCCAACCTTCTTCTTTATTTCATGGCTTGGGAGCTTCAAGCTTGTTCTTTATTCTTTTGGTCAAGGCCCCTTATCTGCTCACCCACCCCTCTCTTTATCTCACTTCATTTCTACAGCTTGCCTACCCATCAAGATCAAAAGAAACCAAGAAGACACATCCGAACAAACCCCAAAAAAGCCCCAAAAATCTCCCAGAGATTATGCTCCTAGAGTTTTTCTCTTACTAATAACGATCAAGGCCTATGA...

CDS

Download CDS FASTA

897 bp · LXL04_010026|LXL04_010026|OH1004|CDS

ATGTTCCTTTGTGGTCCAACCTTCTTCTTTATTTCATGGCTTGGGAGCTTCAAGCTTGTTCTTTATTCTTTTGGTCAAGGCCCCTTATCTGCTCACCCACCCCTCTCTTTATCTCACTTCATTTCTACAGCTTGCCTACCCATCAAGATCAAAAGAAACCAAGAAGACACATCCGAACAAACCCCAAAAAAGCCCCAAAAATCTCCCAGAGATTATGCTCCTAGAGTTTTTCTCTTACTAATAACGATCAAGGCCTATGA...

Protein

Download Protein FASTA

298 aa · LXL04_010026|LXL04_010026|OH1004|PROTEIN

MFLCGPTFFFISWLGSFKLVLYSFGQGPLSAHPPLSLSHFISTACLPIKIKRNQEDTSEQTPKKPQKSPRDYAPRVFLLLITIKAYDYKANLHPLLTTSIYAYYIFFWLELLLGVAASLARTLVGAELEPQFDDPHYATSVQDFWGKRWNLMVSSILRPTVYHPSRAIFSRVVPVRWVSVPAVFITFVVSGIMHEIIFYYLGRLTPTWEVTWFFVIQGVWVAIEIVLKKTIGRRFTPIPVLSRGLTLLFVIFTSFWLFFP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010026`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010026

Location Chr02:138343547-138344443 (-)

Description Similar to ASAT1: Acyl-CoA--sterol O-acyltransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51970`	Involved in the esterification of cycloartenol.	Biosynthesis of phytosterol esters: identification of a sterol o-acyltransferase in Arabidopsis.2007 · DOI: 10.1104/pp.107.106278 Involvement of the phospholipid sterol acyltransferase1 in plant sterol homeostasis and leaf senescence.2010 · DOI: 10.1104/pp.109.145672
`At5g55350`	Catalyzes the final step in the synthesis of long-chain linear esters (waxes).	No verified direct reference in this release
`At5g55360`	Catalyzes the final step in the synthesis of long-chain linear esters (waxes).	No verified direct reference in this release
`At1g34520`	Catalyzes the final step in the synthesis of long-chain linear esters (waxes).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010026 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0016127 sterol catabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0008374 O-acyltransferase activity Molecular Function

GO:0047196 long-chain-alcohol O-fatty-acyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G34520

ath:AT3G51970

ath:AT5G55350

ath:AT5G55360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.872

Rank 1 · LXL04_010026 · OH-1004

Nucleus0.054

Rank 2 · LXL04_010026 · OH-1004

Cytoplasm0.050

Rank 3 · LXL04_010026 · OH-1004

Cell membrane0.047

Rank 4 · LXL04_010026 · OH-1004

Golgi apparatus0.037

Rank 5 · LXL04_010026 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13813.12MBOAT_2129-215 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010026	`PF13813.12`	MBOAT_2	129	215	2e-18	67.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SV07`	Arabidopsis thaliana	Acyl-CoA--sterol O-acyltransferase 1	45.878%	Swiss-Prot	moderate database homology
`Q9FJ75`	Arabidopsis thaliana	Probable long-chain-alcohol O-fatty-acyltransferase 4	40.426%	Swiss-Prot	moderate database homology
`Q9FJ74`	Arabidopsis thaliana	Probable long-chain-alcohol O-fatty-acyltransferase 3	41.259%	Swiss-Prot	moderate database homology
`Q9LNL1`	Arabidopsis thaliana	Probable long-chain-alcohol O-fatty-acyltransferase 8	38.351%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card