LXL04_006785 | RubberDandelionOmics

Gene overview

LXL04_006785

Reference: OH-1004 Chr: Chr02 Coordinates: 25143622-25145102 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1194 bp · LXL04_006785|LXL04_006785|OH1004|cDNA

ATGGCCTTTGGTCCCGTCACTCAAACCCTAGATCCTTGCCAACACACCTCAGAATCCCCTAACGACAACCCCGACGACCACATCTGCTCCGAAACAATAAGCGCCATTGATCCAGAATCGGTAGCGAATCACGAATCATCATTTTTTGGCAGTCCAAATGGCTACTTGACTGGAGATGCCAGAATCGAGAAAGCGTGGGCACATTGGAAGAAACTTGGTGAACCTAAGCTAATTGTAGCACCTATGGTTGATAATTCGGA...

CDS

Download CDS FASTA

1194 bp · LXL04_006785|LXL04_006785|OH1004|CDS

ATGGCCTTTGGTCCCGTCACTCAAACCCTAGATCCTTGCCAACACACCTCAGAATCCCCTAACGACAACCCCGACGACCACATCTGCTCCGAAACAATAAGCGCCATTGATCCAGAATCGGTAGCGAATCACGAATCATCATTTTTTGGCAGTCCAAATGGCTACTTGACTGGAGATGCCAGAATCGAGAAAGCGTGGGCACATTGGAAGAAACTTGGTGAACCTAAGCTAATTGTAGCACCTATGGTTGATAATTCGGA...

Protein

Download Protein FASTA

397 aa · LXL04_006785|LXL04_006785|OH1004|PROTEIN

MAFGPVTQTLDPCQHTSESPNDNPDDHICSETISAIDPESVANHESSFFGSPNGYLTGDARIEKAWAHWKKLGEPKLIVAPMVDNSELPFRLLCRKYGAEAAYTPMLHSRIFSENEKIRSQEFTTCKEDRPLFVQFCANDPDTLLEAARIVEPYCDYVDINLGCPQRIAKRGNYGAFLMDKLPLVKSLVEKLALNLTVPVSCKIRLFPNLQDTLNYAKMLEDAGCALLAVHGRTRDEKDGKKTRANWESIRAVKNALRIP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006785`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_006785`
Location	Chr02:25143622-25145102 (+)
Description	Similar to Dus1l: tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006785` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0002943 tRNA dihydrouridine synthesis Biological Process GO:0006397 mRNA processing Biological Process GO:0006400 tRNA modification Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0017150 tRNA dihydrouridine synthase activity Molecular Function GO:0050660 flavin adenine dinucleotide binding Molecular Function GO:0102262 tRNA-dihydrouridine16 synthase activity Molecular Function GO:0102263 tRNA-dihydrouridine17 synthase activity Molecular Function GO:0106414 mRNA dihydrouridine synthase activity Molecular Function
KEGG gene cross-reference	hsa:64118 mmu:68730 rno:246185 sce:YML080W spo:2541048 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.483

Rank 1 · LXL04_006785 · OH-1004

Nucleus0.429

Rank 2 · LXL04_006785 · OH-1004

Mitochondrion0.155

Rank 3 · LXL04_006785 · OH-1004

Plastid0.060

Rank 4 · LXL04_006785 · OH-1004

Cell membrane0.053

Rank 5 · LXL04_006785 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01207.24Dus79-361 aa

PF00977.28His_biosynth237-294 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006785	`PF01207.24`	Dus	79	361	1.7e-72	244.9
LXL04_006785	`PF00977.28`	His_biosynth	237	294	8.2e-06	26.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card