LXL04_005564 | RubberDandelionOmics

Gene overview

LXL04_005564

Reference: OH-1004 Chr: Chr01 Coordinates: 168427793-168429820 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

948 bp · LXL04_005564|LXL04_005564|OH1004|cDNA

ATGTGGATATTTGGACGAAAAGGGGAATCGGGTTTCTCAGCTTCATCAACAGCCGAGGAAGTTACTGACGGAATCAACGGATCATGTCTCACTGCCATTGTTACCGGGGCTACAAGTGGTATTGGGGCCGAGACAGCACGAGTTCTTGCCTTACGAGGTGTACATGTAGTGATGGCAGTAAGAAACACAGACGCCGGTAAAAAAGTTAGAGAAACTATACTTGAAGAAACACCTGATGCTAAAGTCGATATAATGGAGCT...

CDS

Download CDS FASTA

948 bp · LXL04_005564|LXL04_005564|OH1004|CDS

ATGTGGATATTTGGACGAAAAGGGGAATCGGGTTTCTCAGCTTCATCAACAGCCGAGGAAGTTACTGACGGAATCAACGGATCATGTCTCACTGCCATTGTTACCGGGGCTACAAGTGGTATTGGGGCCGAGACAGCACGAGTTCTTGCCTTACGAGGTGTACATGTAGTGATGGCAGTAAGAAACACAGACGCCGGTAAAAAAGTTAGAGAAACTATACTTGAAGAAACACCTGATGCTAAAGTCGATATAATGGAGCT...

Protein

Download Protein FASTA

315 aa · LXL04_005564|LXL04_005564|OH1004|PROTEIN

MWIFGRKGESGFSASSTAEEVTDGINGSCLTAIVTGATSGIGAETARVLALRGVHVVMAVRNTDAGKKVRETILEETPDAKVDIMELDLSSQASVRDFAAKYRSSGLPLHILINNAGVAVPKFTLSKDKIELHFSTNHLGHFLLTNLLLETMKITSHDQKVEGRIINVSSNGHRFANKGTFSVNQINDESSYYHVYAYGQSKLANILHANELARRLKEEGVNITANSLHPGFIITEIFRDFTIFKVICNAILRHVVKDIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005564`
TK1151 ID	TkA01G034210
OH-1004 ID	LXL04_005564
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005564

Location Chr01:168427793-168429820 (-)

Description Similar to TIC32: Short-chain dehydrogenase TIC 32, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23430`	Involved in protein precursor import into chloroplasts.	Tic32, an essential component in chloroplast biogenesis.2004 · DOI: 10.1074/jbc.m402817200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005564 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0030178 negative regulation of Wnt signaling pathway Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0071560 cellular response to transforming growth factor beta stimulus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005764 lysosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT4G23430

bna:106397857

mmu:80707

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.324

Rank 1 · LXL04_005564 · OH-1004

Cytoplasm0.296

Rank 2 · LXL04_005564 · OH-1004

Mitochondrion0.171

Rank 3 · LXL04_005564 · OH-1004

Peroxisome0.096

Rank 4 · LXL04_005564 · OH-1004

Nucleus0.096

Rank 5 · LXL04_005564 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106.32adh_short31-240 aa

PF08659.17KR31-126 aa

PF01370.28Epimerase33-213 aa

PF13561.13adh_short_C236-281 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005564	`PF00106.32`	adh_short	31	240	3.2e-32	112.3
LXL04_005564	`PF08659.17`	KR	31	126	1.9e-08	35.1
LXL04_005564	`PF01370.28`	Epimerase	33	213	4.9e-06	26.9
LXL04_005564	`PF13561.13`	adh_short_C2	36	281	3.9e-20	73.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A2RVM0`	Arabidopsis thaliana	Short-chain dehydrogenase TIC 32, chloroplastic	62.975%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card