LXL04_004377 | RubberDandelionOmics

Gene overview

LXL04_004377

Reference: OH-1004 Chr: Chr01 Coordinates: 133977209-133977951 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

285 bp · LXL04_004377|LXL04_004377|OH1004|cDNA

ATGAAGGAACGAGAAACAAATCGAAGGCCAATAGCCATCGCGATGACGATTCCAGAATCCATACTTTCAGTGTCAATCTTGCTGGATATGCAAGCACGATTATTACTCGACATGTTAGGAAAAGGAATAGAATCAAGTCTCATTAACCCTTCAGCTCTAGTTGACAAGCCATGGCAGGCATCTGGTGAGACATTAAACAACATTGACCATGAAGCAATGGCATACGTTGATGCTGTTCTTGATCTCGCATCACATTTTAT...

CDS

Download CDS FASTA

285 bp · LXL04_004377|LXL04_004377|OH1004|CDS

ATGAAGGAACGAGAAACAAATCGAAGGCCAATAGCCATCGCGATGACGATTCCAGAATCCATACTTTCAGTGTCAATCTTGCTGGATATGCAAGCACGATTATTACTCGACATGTTAGGAAAAGGAATAGAATCAAGTCTCATTAACCCTTCAGCTCTAGTTGACAAGCCATGGCAGGCATCTGGTGAGACATTAAACAACATTGACCATGAAGCAATGGCATACGTTGATGCTGTTCTTGATCTCGCATCACATTTTAT...

Protein

Download Protein FASTA

94 aa · LXL04_004377|LXL04_004377|OH1004|PROTEIN

MKERETNRRPIAIAMTIPESILSVSILLDMQARLLLDMLGKGIESSLINPSALVDKPWQASGETLNNIDHEAMAYVDAVLDLASHFITKLQAML

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004377`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004377

Location Chr01:133977209-133977951 (+)

Description Similar to MED16: Mediator of RNA polymerase II transcription subunit 16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04920`	Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.	The sfr6 mutant of Arabidopsis is defective in transcriptional activation via CBF/DREB1 and DREB2 and shows sensitivity to osmotic stress.2003 · DOI: 10.1046/j.1365-313x.2003.01734.x Sensitive to freezing6 integrates cellular and environmental inputs to the plant circadian clock.2008 · DOI: 10.1104/pp.108.123901 Identification of SFR6, a key component in cold acclimation acting post-translationally on CBF function.2009 · DOI: 10.1111/j.1365-313x.2008.03763.x The Mediator subunit SFR6/MED16 controls defence gene expression mediated by salicylic acid and jasmonate responsive pathways.2012 · DOI: 10.1111/j.1469-8137.2012.04138.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004377 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010091 trichome branching Biological Process

GO:0010104 regulation of ethylene-activated signaling pathway Biological Process

GO:0032922 circadian regulation of gene expression Biological Process

GO:0048364 root development Biological Process

GO:0048586 regulation of long-day photoperiodism, flowering Biological Process

GO:1901672 positive regulation of systemic acquired resistance Biological Process

GO:1902066 regulation of cell wall pectin metabolic process Biological Process

KEGG gene cross-reference

ath:AT4G04920

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.323

Rank 1 · LXL04_004377 · OH-1004

Plastid0.264

Rank 2 · LXL04_004377 · OH-1004

Cytoplasm0.181

Rank 3 · LXL04_004377 · OH-1004

Nucleus0.131

Rank 4 · LXL04_004377 · OH-1004

Extracellular0.056

Rank 5 · LXL04_004377 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30926.1MED16_helical25-91 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004377	`PF30926.1`	MED16_helical	25	91	1.6e-28	100.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JGZ1`	Arabidopsis thaliana	Mediator of RNA polymerase II transcription subunit 16	64.103%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card