LXL04_003892 | RubberDandelionOmics

Gene overview

LXL04_003892

Reference: OH-1004 Chr: Chr01 Coordinates: 112258215-112261633 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1530 bp · LXL04_003892|LXL04_003892|OH1004|cDNA

ATGGTTTGCACTGCAAATGAGTTATTGGGGTGGAAAGATTTTCCAAAGGGTCTTAGAGTCTTGCTACTTGATGAAGACATCGATTCTGCAGCAGAAATAAGATCAAAACTTGAAGAAATGGATTATGTTGTTTCTACGTTCTATAGTGAGCCTGAAGCATTGTCGGCCATTTCAGACAAATCTAAAGGCTTCCATGTAGCCATAGTAGAGGTGAGAGCACACAACGAAGAAGGAAGGTTAAAATTTCTAGAATGCACGAA...

CDS

Download CDS FASTA

1530 bp · LXL04_003892|LXL04_003892|OH1004|CDS

ATGGTTTGCACTGCAAATGAGTTATTGGGGTGGAAAGATTTTCCAAAGGGTCTTAGAGTCTTGCTACTTGATGAAGACATCGATTCTGCAGCAGAAATAAGATCAAAACTTGAAGAAATGGATTATGTTGTTTCTACGTTCTATAGTGAGCCTGAAGCATTGTCGGCCATTTCAGACAAATCTAAAGGCTTCCATGTAGCCATAGTAGAGGTGAGAGCACACAACGAAGAAGGAAGGTTAAAATTTCTAGAATGCACGAA...

Protein

Download Protein FASTA

509 aa · LXL04_003892|LXL04_003892|OH1004|PROTEIN

MVCTANELLGWKDFPKGLRVLLLDEDIDSAAEIRSKLEEMDYVVSTFYSEPEALSAISDKSKGFHVAIVEVRAHNEEGRLKFLECTKDLPTIMTSDVKCISTMMKCISLGAVEFLEKPLSEDKLRNIWQHVAHKAFNAGPKDQFEALQSDKVTDHLEKVSIKEELIQNQEHNEEVLVESDKYPAPSTPQLKQGVRQVENEDGATGSNEKEFTDHDGEPKFVENTCDGLLVAETSIETNSSKSLEEGSGKPSSKECCPDPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003892`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003892

Location Chr01:112258215-112261633 (+)

Description Similar to APRR2: Two-component response regulator-like APRR2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18020`	Transcriptional activator that binds specifically to the DNA sequence 5'-[AG]GATT-3'.	No verified direct reference in this release
`At5g44190`	Transcriptional activator that functions with GLK1 to promote chloroplast development.	Arabidopsis GARP transcriptional activators interact with the Pro-rich activation domain shared by G-box-binding bZIP factors.2002 · DOI: 10.1093/pcp/pcf011 GLK gene pairs regulate chloroplast development in diverse plant species.2002 · DOI: 10.1046/j.1365-313x.2002.01390.x GLK transcription factors regulate chloroplast development in a cell-autonomous manner.2008 · DOI: 10.1111/j.1365-313x.2008.03616.x GLK transcription factors coordinate expression of the photosynthetic apparatus in Arabidopsis.2009 · DOI: 10.1105/tpc.108.065250 Specialization of the Golden2-like regulatory pathway during land plant evolution.2009 · DOI: 10.1111/j.1469-8137.2009.02829.x ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription.2013 · DOI: 10.1038/embor.2013.24
`At2g20570`	Transcriptional activator that functions with GLK2 to promote chloroplast development.	Arabidopsis GARP transcriptional activators interact with the Pro-rich activation domain shared by G-box-binding bZIP factors.2002 · DOI: 10.1093/pcp/pcf011 GLK gene pairs regulate chloroplast development in diverse plant species.2002 · DOI: 10.1046/j.1365-313x.2002.01390.x The GLK1 'regulon' encodes disease defense related proteins and confers resistance to Fusarium graminearum in Arabidopsis.2007 · DOI: 10.1016/j.bbrc.2007.05.084 GLK transcription factors regulate chloroplast development in a cell-autonomous manner.2008 · DOI: 10.1111/j.1365-313x.2008.03616.x GLK transcription factors coordinate expression of the photosynthetic apparatus in Arabidopsis.2009 · DOI: 10.1105/tpc.108.065250 Specialization of the Golden2-like regulatory pathway during land plant evolution.2009 · DOI: 10.1111/j.1469-8137.2009.02829.x Coordination of plastid protein import and nuclear gene expression by plastid-to-nucleus retrograde signaling.2009 · DOI: 10.1104/pp.109.145987 ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription.2013 · DOI: 10.1038/embor.2013.24
`At4g16110`	Transcriptional activator that binds specifically to the DNA sequence 5'-[AG]GATT-3'.	The response regulator ARR2: a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis.2001 · DOI: 10.1007/s004380000400 Two-component circuitry in Arabidopsis cytokinin signal transduction.2001 · DOI: 10.1038/35096500 The response regulator 2 mediates ethylene signalling and hormone signal integration in Arabidopsis.2004 · DOI: 10.1038/sj.emboj.7600337 Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis.2006 · DOI: 10.1073/pnas.0505150103

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0239000`	Probable transcriptional activator that promotes chloroplast development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003892 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000160 phosphorelay signal transduction system Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0007165 signal transduction Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0010119 regulation of stomatal movement Biological Process

KEGG gene cross-reference

ath:AT2G20570

ath:AT4G16110

ath:AT4G18020

ath:AT5G44190

dosa:Os01g0239000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · LXL04_003892 · OH-1004

Cytoplasm0.098

Rank 2 · LXL04_003892 · OH-1004

Cell membrane0.035

Rank 3 · LXL04_003892 · OH-1004

Endoplasmic reticulum0.017

Rank 4 · LXL04_003892 · OH-1004

Plastid0.011

Rank 5 · LXL04_003892 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00072.31Response_reg20-126 aa

PF00249.38Myb_DNA-binding287-335 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003892	`PF00072.31`	Response_reg	20	126	5.5e-08	33.7
LXL04_003892	`PF00249.38`	Myb_DNA-binding	287	335	6.9e-08	33.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6LA43`	Arabidopsis thaliana	Two-component response regulator-like APRR2	46.154%	Swiss-Prot	moderate database homology
`Q9FFH0`	Arabidopsis thaliana	Transcription activator GLK2	39.844%	Swiss-Prot	weak database homology
`Q9SIV3`	Arabidopsis thaliana	Transcription activator GLK1	30.986%	Swiss-Prot	moderate database homology
`Q9ZWJ9`	Arabidopsis thaliana	Two-component response regulator ARR2	46.729%	Swiss-Prot	weak database homology
`Q5NAN5`	Oryza sativa subsp. japonica	Probable transcription factor GLK2	48.246%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card