LXL04_003442 | RubberDandelionOmics

Gene overview

LXL04_003442

Reference: OH-1004 Chr: Chr01 Coordinates: 79178967-79181472 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

885 bp · LXL04_003442|LXL04_003442|OH1004|cDNA

ATGGCGACAGACCCGCCGGAGGGGTACGGAGACGACTTTCTTGAACAAATTCTCGCGATTCCTGCTTACAACATCTCCGGATGCTTGCCTGGTAATACTACCGATGCTAATGCTTCTGATACGGTGTCCGTTCATCAtcaacagcaacagcagcaaccGGTGTTTCCGTTAGGTTTGAGCTTAGATAATGGCCGTGAAACAATCGGTGCGTTTGCAGGGCAGCAACAGCAGCAGAGGGACAGAGGAGTGAGTATGAACAT...

CDS

Download CDS FASTA

885 bp · LXL04_003442|LXL04_003442|OH1004|CDS

ATGGCGACAGACCCGCCGGAGGGGTACGGAGACGACTTTCTTGAACAAATTCTCGCGATTCCTGCTTACAACATCTCCGGATGCTTGCCTGGTAATACTACCGATGCTAATGCTTCTGATACGGTGTCCGTTCATCATCAACAGCAACAGCAGCAACCGGTGTTTCCGTTAGGTTTGAGCTTAGATAATGGCCGTGAAACAATCGGTGCGTTTGCAGGGCAGCAACAGCAGCAGAGGGACAGAGGAGTGAGTATGAACAT...

Protein

Download Protein FASTA

294 aa · LXL04_003442|LXL04_003442|OH1004|PROTEIN

MATDPPEGYGDDFLEQILAIPAYNISGCLPGNTTDANASDTVSVHHQQQQQQPVFPLGLSLDNGRETIGAFAGQQQQQRDRGVSMNMSGLFPSFENLQSHSLLHSVPQAFQGQSTTSTAVTVPHPPSIRPRVRARRGQATDPHSIAERLRRERIAERMRALQELVPSCNKTDKAAMLDEILDYVKFLRLQVKVLSMSRLGGAGAVAQLVSDVPLQSVEGDASENGYNQPAWENWSNDDTEREVAKLMEEDVGAAMQFLQS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003442`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003442

Location Chr01:79178967-79181472 (+)

Description Similar to UNE12: Transcription factor UNE12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02590`	Required for ovule fertilization.	No verified direct reference in this release
`At1g03040`	Transcription factor bHLH7.	No verified direct reference in this release
`At2g24260`	Transcription factor that regulates the development of root hairs.	Conservation of lotus and Arabidopsis basic helix-loop-helix proteins reveals new players in root hair development.2009 · DOI: 10.1104/pp.109.143867
`At4g30980`	Transcription factor that regulates the development of root hairs.	Conservation of lotus and Arabidopsis basic helix-loop-helix proteins reveals new players in root hair development.2009 · DOI: 10.1104/pp.109.143867

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003442 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0048235 pollen sperm cell differentiation Biological Process

GO:0048765 root hair cell differentiation Biological Process

GO:0048767 root hair elongation Biological Process

GO:0055046 microgametogenesis Biological Process

GO:0080147 root hair cell development Biological Process

KEGG gene cross-reference

ath:AT1G03040

ath:AT2G24260

ath:AT4G02590

ath:AT4G30980

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.973

Rank 1 · LXL04_003442 · OH-1004

Cytoplasm0.098

Rank 2 · LXL04_003442 · OH-1004

Cell membrane0.025

Rank 3 · LXL04_003442 · OH-1004

Endoplasmic reticulum0.019

Rank 4 · LXL04_003442 · OH-1004

Plastid0.012

Rank 5 · LXL04_003442 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH143-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003442	`PF00010.32`	HLH	143	188	1.1e-08	35.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22768`	Arabidopsis thaliana	Transcription factor UNE12	52.769%	Swiss-Prot	strong database homology
`Q93Y00`	Arabidopsis thaliana	Transcription factor bHLH7	60.744%	Swiss-Prot	strong database homology
`Q9ZUG9`	Arabidopsis thaliana	Transcription factor LRL1	46.014%	Swiss-Prot	moderate database homology
`Q8S3D5`	Arabidopsis thaliana	Transcription factor LRL2	53.731%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card