LXL04_002908 | RubberDandelionOmics

Gene overview

LXL04_002908

Reference: OH-1004 Chr: Chr01 Coordinates: 60948063-60950699 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1494 bp · LXL04_002908|LXL04_002908|OH1004|cDNA

ATGCCTCGCGAAATCATCAATTTGCAAGTAGGGCAATGTGGAAATCAGATCGGGATGGAGTTCTGGAAACAACTATGCCTTGAACACGGGATATCTAAGGACGGCATTCTCGAGGAATACGCCACTCAGGTTACATATGAACATCAATGTTATGAACGTTTACGCTTCCTTATCTGTAACAATCTGATTGAATTCATACTGACATACAACTTGTTCCAGGGAGGTGCAGGTGACAGGAAAGACGTATTCTTCTATCAAGC...

CDS

Download CDS FASTA

1494 bp · LXL04_002908|LXL04_002908|OH1004|CDS

ATGCCTCGCGAAATCATCAATTTGCAAGTAGGGCAATGTGGAAATCAGATCGGGATGGAGTTCTGGAAACAACTATGCCTTGAACACGGGATATCTAAGGACGGCATTCTCGAGGAATACGCCACTCAGGTTACATATGAACATCAATGTTATGAACGTTTACGCTTCCTTATCTGTAACAATCTGATTGAATTCATACTGACATACAACTTGTTCCAGGGAGGTGCAGGTGACAGGAAAGACGTATTCTTCTATCAAGC...

Protein

Download Protein FASTA

497 aa · LXL04_002908|LXL04_002908|OH1004|PROTEIN

MPREIINLQVGQCGNQIGMEFWKQLCLEHGISKDGILEEYATQVTYEHQCYERLRFLICNNLIEFILTYNLFQGGAGDRKDVFFYQADDQHYIPRALLVDLEPRVINGIQTGEYRDLYNHENIFISQEGAGAGNNWASGYDQGKHFEEDLMDMIDREADGSDSLEGFVLCHSIAGGTGSGMGSYILETLNDHYSKKLIQTYSVFPNQNETSDVVVQPYNSLLTLKRLTLNADCVVVIDNTALNRIAVERLHIQNPTVSET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002908`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002908

Location Chr01:60948063-60950699 (+)

Description Similar to TUBG2: Tubulin gamma-2 chain

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05620`	Tubulin is the major constituent of microtubules.	Feeding cells induced by phytoparasitic nematodes require γ-tubulin ring complex for microtubule reorganization.2011 · DOI: 10.1371/journal.ppat.1002343
`At3g61650`	Tubulin is the major constituent of microtubules.	Feeding cells induced by phytoparasitic nematodes require γ-tubulin ring complex for microtubule reorganization.2011 · DOI: 10.1371/journal.ppat.1002343

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0156600`	Tubulin is the major constituent of microtubules.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002908 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000070 mitotic sister chromatid segregation Biological Process

GO:0000212 meiotic spindle organization Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0007020 microtubule nucleation Biological Process

GO:0007052 mitotic spindle organization Biological Process

GO:0009624 response to nematode Biological Process

GO:0010103 stomatal complex morphogenesis Biological Process

GO:0031122 cytoplasmic microtubule organization Biological Process

GO:0046785 microtubule polymerization Biological Process

GO:0048366 leaf development Biological Process

GO:0048768 root hair cell tip growth Biological Process

KEGG gene cross-reference

ath:AT3G61650

ath:AT5G05620

dosa:Os05g0156600

zma:542436

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.609

Rank 1 · LXL04_002908 · OH-1004

Mitochondrion0.200

Rank 2 · LXL04_002908 · OH-1004

Nucleus0.143

Rank 3 · LXL04_002908 · OH-1004

Peroxisome0.077

Rank 4 · LXL04_002908 · OH-1004

Cell membrane0.037

Rank 5 · LXL04_002908 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00091.32Tubulin4-246 aa

PF03953.23Tubulin_C296-331 aa

PF03953.23Tubulin_C329-397 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002908	`PF00091.32`	Tubulin	4	246	2e-60	205.1
LXL04_002908	`PF03953.23`	Tubulin_C	296	331	9.6e-30	104.1
LXL04_002908	`PF03953.23`	Tubulin_C	329	397	9.6e-30	104.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P38558`	Arabidopsis thaliana	Tubulin gamma-2 chain	76.506%	Swiss-Prot	strong database homology
`P38557`	Arabidopsis thaliana	Tubulin gamma-1 chain	76.506%	Swiss-Prot	strong database homology
`O49068`	Oryza sativa subsp. japonica	Tubulin gamma-2 chain	76.337%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card