LXL04_002776 | RubberDandelionOmics

Gene overview

LXL04_002776

Reference: OH-1004 Chr: Chr01 Coordinates: 58115052-58118109 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2229 bp · LXL04_002776|LXL04_002776|OH1004|cDNA

ATGGCCGGAGGAGGCTACAATAAGCAAAAGCTCAACAAATCCAAGAACCGAAAACCCCTGAAACCATCTCCATTTGTGGAGGCTGGTTTGTTATCCGATTGGTCTCCCGTTGTTGATTCTCCCTCTCCCAGAGGAAAGAGTAATAATGGCAACAATAGTGGAAATTATTCGAATGCGTCGAAGAACAAATCTGCAGCGAGATTTGCGAGCGGGAGTGGTTCTGGTGGTAAATCAAAAGCCTCGAGTTCCAATCCGAGAAA...

CDS

Download CDS FASTA

2229 bp · LXL04_002776|LXL04_002776|OH1004|CDS

ATGGCCGGAGGAGGCTACAATAAGCAAAAGCTCAACAAATCCAAGAACCGAAAACCCCTGAAACCATCTCCATTTGTGGAGGCTGGTTTGTTATCCGATTGGTCTCCCGTTGTTGATTCTCCCTCTCCCAGAGGAAAGAGTAATAATGGCAACAATAGTGGAAATTATTCGAATGCGTCGAAGAACAAATCTGCAGCGAGATTTGCGAGCGGGAGTGGTTCTGGTGGTAAATCAAAAGCCTCGAGTTCCAATCCGAGAAA...

Protein

Download Protein FASTA

742 aa · LXL04_002776|LXL04_002776|OH1004|PROTEIN

MAGGGYNKQKLNKSKNRKPLKPSPFVEAGLLSDWSPVVDSPSPRGKSNNGNNSGNYSNASKNKSAARFASGSGSGGKSKASSSNPRNVEQQKPKMNAIGYIYPQVMVSLSEHTQIDPLLDESGDGSNKLDESDPLVIVDTKESKLVAFGDQTPVKDPETVKYGYESVTEASLEVDDSFHRGLGFHEEEEEEEEEEEEEDPSVTEASPFIENKEVSISDSSSSEEIETDEEEEDEDDDIADEEESLDSSESEDSSNSSDSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002776`
TK1151 ID	TkA01G421440
OH-1004 ID	LXL04_002776
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002776

Location Chr01:58115052-58118109 (+)

Description Similar to GPATCH2: G patch domain-containing protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g24830`	Zinc finger CCCH domain-containing protein 22.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002776 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function

GO:0001227 DNA-binding transcription repressor activity, RNA polymerase II-specific Molecular Function

GO:0003676 nucleic acid binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

aag:5564857

ath:AT2G24830

dmo:Dmoj_GI17578

hsa:55105

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.642

Rank 1 · LXL04_002776 · OH-1004

Cytoplasm0.371

Rank 2 · LXL04_002776 · OH-1004

Cell membrane0.079

Rank 3 · LXL04_002776 · OH-1004

Endoplasmic reticulum0.053

Rank 4 · LXL04_002776 · OH-1004

Mitochondrion0.025

Rank 5 · LXL04_002776 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01424.29R3H415-472 aa

PF01585.29G-patch619-662 aa

PF12656.13G-patch_2621-663 aa

PF01585.29G-patch698-742 aa

PF12656.13G-patch_2700-742 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002776	`PF01424.29`	R3H	415	472	4.9e-09	36.8
LXL04_002776	`PF01585.29`	G-patch	619	662	3.5e-28	98.0
LXL04_002776	`PF12656.13`	G-patch_2	621	663	2.7e-10	40.8
LXL04_002776	`PF01585.29`	G-patch	698	742	3.5e-28	98.0
LXL04_002776	`PF12656.13`	G-patch_2	700	742	2.7e-10	40.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SK49`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 22	58.696%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card