RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_001595
Reference: OH-1004 Chr: Chr01 Coordinates: 29792701-29795465 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1953 bp · LXL04_001595|LXL04_001595|OH1004|cDNA

ATGGCGGCGCAAGTTATTCAACCTCAATCGGTCAATGGCGGTGCTGCATCTGGTGGTAACGCTCAGCAATTCGTGCCGACGTCGCTGTATGTCGGTGATCTGGAGATGAACGTCACCGATTCGCAACTGTTCGAGCTGTTTAGCCAGCTAGGGCAGGTGGTTTCGGTTCGTGTTTGCAGGGACTTGTCTACTCGACGCTCTCTTGGTTATGGCTATGTCAACTATGTCAACCCCCAAGATGCTGCAAGGGCGATAGAGGT...

CDS

Download CDS FASTA

1953 bp · LXL04_001595|LXL04_001595|OH1004|CDS

ATGGCGGCGCAAGTTATTCAACCTCAATCGGTCAATGGCGGTGCTGCATCTGGTGGTAACGCTCAGCAATTCGTGCCGACGTCGCTGTATGTCGGTGATCTGGAGATGAACGTCACCGATTCGCAACTGTTCGAGCTGTTTAGCCAGCTAGGGCAGGTGGTTTCGGTTCGTGTTTGCAGGGACTTGTCTACTCGACGCTCTCTTGGTTATGGCTATGTCAACTATGTCAACCCCCAAGATGCTGCAAGGGCGATAGAGGT...

Protein

Download Protein FASTA

650 aa · LXL04_001595|LXL04_001595|OH1004|PROTEIN

MAAQVIQPQSVNGGAASGGNAQQFVPTSLYVGDLEMNVTDSQLFELFSQLGQVVSVRVCRDLSTRRSLGYGYVNYVNPQDAARAIEVLNFTPLNGKSVRIMYSHRDPSVRKSGSGNIFIKNLDKAIDQKALHDTFSTFGNILSCKIATDMTGQSKGYGFVQYDTEEAAQQAIEKLNGMLLNDKQVYVGPFLRKQEREMAVDKTKFTNVFVKNLSESTTDDDLNKAFSEYGTITSAVVMRDAEGNSKCFGFVNFENAEDAA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_001595
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_001595
LocationChr01:29792701-29795465 (+)
DescriptionSimilar to PAB2: Polyadenylate-binding protein 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g34110 Binds the poly(A) tail of mRNA. No verified direct reference in this release
At1g49760 Binds the poly(A) tail of mRNA. No verified direct reference in this release
At2g23350 Binds the poly(A) tail of mRNA. No verified direct reference in this release
At1g71770 Binds the poly(A) tail of mRNA.
Differential organ-specific expression of three poly(A)-binding-protein genes from Arabidopsis thaliana.1993 · DOI: 10.1073/pnas.90.14.6686
A pollen-, ovule-, and early embryo-specific poly(A) binding protein from Arabidopsis complements essential functions in yeast.1996 · DOI: 10.1105/tpc.8.8.1261
At1g22760 Binds the poly(A) tail of mRNA.
Unexpected complexity of poly(A)-binding protein gene families in flowering plants: three conserved lineages that are at least 200 million years old and possible auto- and cross-regulation.2003 · DOI: 10.1093/genetics/163.1.311
Evidence that poly(A) binding protein has an evolutionarily conserved function in facilitating mRNA biogenesis and export.2003 · DOI: 10.1261/rna.5128903

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001595 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process
GO:0000289 nuclear-transcribed mRNA poly(A) tail shortening Biological Process
GO:0006397 mRNA processing Biological Process
GO:0006413 translational initiation Biological Process
GO:0006417 regulation of translation Biological Process
GO:0006446 regulation of translational initiation Biological Process
GO:0048255 mRNA stabilization Biological Process
GO:0060211 regulation of nuclear-transcribed mRNA poly(A) tail shortening Biological Process
GO:1900151 regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
KEGG gene cross-reference
ath:AT1G22760
ath:AT1G49760
ath:AT1G71770
ath:AT2G23350
ath:AT4G34110
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.674
Rank 1 · LXL04_001595 · OH-1004
Nucleus0.452
Rank 2 · LXL04_001595 · OH-1004
Cell membrane0.067
Rank 3 · LXL04_001595 · OH-1004
Mitochondrion0.055
Rank 4 · LXL04_001595 · OH-1004
Endoplasmic reticulum0.051
Rank 5 · LXL04_001595 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_129-98 aa
PF00076.29RRM_1117-185 aa
PF00076.29RRM_1208-276 aa
PF16842.12RRM_occluded211-281 aa
PF00076.29RRM_1311-379 aa
PF00658.25MLLE553-618 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_001595PF00076.29RRM_129981e-91301.5
LXL04_001595PF00076.29RRM_11171851e-91301.5
LXL04_001595PF00076.29RRM_12082761e-91301.5
LXL04_001595PF16842.12RRM_occluded2112811.2e-1145.0
LXL04_001595PF00076.29RRM_13113791e-91301.5
LXL04_001595PF00658.25MLLE5536188.8e-29100.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
P42731Arabidopsis thalianaPolyadenylate-binding protein 270.382%Swiss-Protstrong database homology
Q9FXA2Arabidopsis thalianaPolyadenylate-binding protein 871.024%Swiss-Protstrong database homology
O22173Arabidopsis thalianaPolyadenylate-binding protein 466.456%Swiss-Protstrong database homology
Q05196Arabidopsis thalianaPolyadenylate-binding protein 554.664%Swiss-Protstrong database homology
O64380Arabidopsis thalianaPolyadenylate-binding protein 355.829%Swiss-Protstrong database homology

JBrowse

View in Genome Browser