LXL04_000436 | RubberDandelionOmics

Gene overview

LXL04_000436

Reference: OH-1004 Chr: Chr01 Coordinates: 8221290-8222534 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

825 bp · LXL04_000436|LXL04_000436|OH1004|cDNA

ATGAAAATTACACAACGGTTCAATCGAGTTATTAAACCCCTAAAACCCGTGGATTCTTCCACGAAAGATCCCAAACCTTCAATTTCTAAATCCAAACCAAATTTCAAACCAAAACTAAAGACAAAACTTGGAACAATTAAGCAAAAACTCCCAACCCTACCCGCTCTTCAATCGGAAGAATCAAAACCCACATTTTCTCTTGAGAAATCCCGAATACTGGGTCCTGAGTTTTACCAAATCGACGCCCTTGATCTTGCACC...

CDS

Download CDS FASTA

825 bp · LXL04_000436|LXL04_000436|OH1004|CDS

ATGAAAATTACACAACGGTTCAATCGAGTTATTAAACCCCTAAAACCCGTGGATTCTTCCACGAAAGATCCCAAACCTTCAATTTCTAAATCCAAACCAAATTTCAAACCAAAACTAAAGACAAAACTTGGAACAATTAAGCAAAAACTCCCAACCCTACCCGCTCTTCAATCGGAAGAATCAAAACCCACATTTTCTCTTGAGAAATCCCGAATACTGGGTCCTGAGTTTTACCAAATCGACGCCCTTGATCTTGCACC...

Protein

Download Protein FASTA

274 aa · LXL04_000436|LXL04_000436|OH1004|PROTEIN

MKITQRFNRVIKPLKPVDSSTKDPKPSISKSKPNFKPKLKTKLGTIKQKLPTLPALQSEESKPTFSLEKSRILGPEFYQIDALDLAPRLLGKYLRRDDVVLQITEVEAYRSNDSACHGRVGITPRTAPLFGTGGHAYVYLCYGLHTMLNVVADKEGIGSAVLIRSCAPVAGLETIKQRRGLDTEKPILLTGPGKVGQALGISKEWSSHALFAPGGLEVLDGPEVEEMVVGPRVGIDYALPEDLNALWRFAIAGSVWISAP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000436`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000436

Location Chr01:8221290-8222534 (+)

Description Similar to MAG: DNA-3-methyladenine glycosylase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12040`	Hydrolysis of the deoxyribose N-glycosidic bond to excise 3-methyladenine, and 7-methylguanine from the damaged DNA polymer formed by alkylation lesions.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000436 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006284 base-excision repair Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003905 alkylbase DNA N-glycosylase activity Molecular Function

KEGG gene cross-reference

ath:AT3G12040

cpc:Cpar_0350

noc:Noc_0079

rci:RCIX1098

rpb:RPB_2889

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.582

Rank 1 · LXL04_000436 · OH-1004

Nucleus0.509

Rank 2 · LXL04_000436 · OH-1004

Mitochondrion0.099

Rank 3 · LXL04_000436 · OH-1004

Endoplasmic reticulum0.026

Rank 4 · LXL04_000436 · OH-1004

Cell membrane0.022

Rank 5 · LXL04_000436 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02245.22Pur_DNA_glyco76-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000436	`PF02245.22`	Pur_DNA_glyco	76	254	1.7e-52	178.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39147`	Arabidopsis thaliana	DNA-3-methyladenine glycosylase	75.000%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card