LXL04_000206 | RubberDandelionOmics

Gene overview

LXL04_000206

Reference: OH-1004 Chr: Chr01 Coordinates: 4067554-4068689 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

873 bp · LXL04_000206|LXL04_000206|OH1004|cDNA

ATGAGGGAGGACGAGTCCAATTGGTTTTCAAAGTGGGAGGAAGAACTGCCGTCGCCGGACGACCTTATGCCCTTGTCGCAAACCCTAATCACTCCTGATCTAGCAATCGCTTTTGATATCCGAAGCCCACATAACCACCATACACCTTCACTTCAGCACCACCAACAACCGCCGCCGATTTCAACCCCTTCTTCTCAACCCAATTCTGGGGAATTTGATTCCCCTGAACTCGGCGGTGGTGGATCCGGCGATGAACCAGC...

CDS

Download CDS FASTA

873 bp · LXL04_000206|LXL04_000206|OH1004|CDS

ATGAGGGAGGACGAGTCCAATTGGTTTTCAAAGTGGGAGGAAGAACTGCCGTCGCCGGACGACCTTATGCCCTTGTCGCAAACCCTAATCACTCCTGATCTAGCAATCGCTTTTGATATCCGAAGCCCACATAACCACCATACACCTTCACTTCAGCACCACCAACAACCGCCGCCGATTTCAACCCCTTCTTCTCAACCCAATTCTGGGGAATTTGATTCCCCTGAACTCGGCGGTGGTGGATCCGGCGATGAACCAGC...

Protein

Download Protein FASTA

290 aa · LXL04_000206|LXL04_000206|OH1004|PROTEIN

MREDESNWFSKWEEELPSPDDLMPLSQTLITPDLAIAFDIRSPHNHHTPSLQHHQQPPPISTPSSQPNSGEFDSPELGGGGSGDEPARTLKRPRLVWTPQLHKRFVDAVAHLGIKNAVPKTIMQLMSVDGLTRENVASHLQKYRLYLKRMQGLSSGSGNGSGGDPATDHLFASSPVPAHFLHQGRPNSDHYLPYVPVAALQQQHHHQHIAAAVAGHHPQLQPRYGQIGHFGSPRNGQFEHPFLSRQSHQQQSIHRVGTPI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000206`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000206

Location Chr01:4067554-4068689 (-)

Description Similar to MYBC1: Transcription factor MYBC1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g40970`	Probable transcription factor that acts as a negative regulator of freezing tolerance via a CBF-independent pathway.	A single-repeat R3-MYB transcription factor MYBC1 negatively regulates freezing tolerance in Arabidopsis.2010 · DOI: 10.1016/j.bbrc.2010.03.114
`At3g46640`	Transcription factor that is essential for the generation of the circadian clock oscillation.	PHYTOCLOCK 1 encoding a novel GARP protein essential for the Arabidopsis circadian clock.2005 · DOI: 10.1111/j.1365-2443.2005.00892.x LUX ARRHYTHMO encodes a nighttime repressor of circadian gene expression in the Arabidopsis core clock.2011 · DOI: 10.1016/j.cub.2010.12.021
`At5g59570`	Transcription factor that is a critical component of the regulatory circuit of the circadian clock.	No verified direct reference in this release
`At3g16857`	Transcriptional activator that binds specifically to the DNA sequence 5'-[AG]GATT-3'.	Two-component circuitry in Arabidopsis cytokinin signal transduction.2001 · DOI: 10.1038/35096500 ARR1, a transcription factor for genes immediately responsive to cytokinins.2001 · DOI: 10.1126/science.1065201 A genetic framework for the control of cell division and differentiation in the root meristem.2008 · DOI: 10.1126/science.1164147

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0971800`	Transcription factor that is essential for the generation of the circadian clock oscillation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000206 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0010380 regulation of chlorophyll biosynthetic process Biological Process

GO:0010468 regulation of gene expression Biological Process

KEGG gene cross-reference

ath:AT2G40970

ath:AT3G16857

ath:AT3G46640

ath:AT5G59570

dosa:Os01g0971800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.983

Rank 1 · LXL04_000206 · OH-1004

Cytoplasm0.083

Rank 2 · LXL04_000206 · OH-1004

Cell membrane0.019

Rank 3 · LXL04_000206 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_000206 · OH-1004

Plastid0.008

Rank 5 · LXL04_000206 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249.38Myb_DNA-binding95-144 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000206	`PF00249.38`	Myb_DNA-binding	95	144	6.2e-09	36.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22210`	Arabidopsis thaliana	Transcription factor MYBC1	63.131%	Swiss-Prot	moderate database homology
`Q9SNB4`	Arabidopsis thaliana	Transcription factor LUX	48.113%	Swiss-Prot	moderate database homology
`Q9LTH4`	Arabidopsis thaliana	Transcription factor BOA	47.596%	Swiss-Prot	moderate database homology
`Q940D0`	Arabidopsis thaliana	Two-component response regulator ARR1	60.000%	Swiss-Prot	weak database homology
`Q94DH3`	Oryza sativa subsp. japonica	Transcription factor PCL1	49.239%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card