TkAUNG012380 | RubberDandelionOmics

Gene overview

TkAUNG012380

Reference: TK1151 Chr: ChrUn Coordinates: 3058223-3059769 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

786 bp · TkAUNG012380|TK1151|cDNA

ATGAAAATGCCAGGATCACTAGGACATGAAGAACAAGATGCTAAAACTTTTGCCTCCTGGGGGGTTGATTACTTGAAGTATGACAATTGTAACAACAACGGTATCAGTCCAAAGGAAAGGTATCCCGTGATGGCAAAAGCTTTACTGAATTCTGGGAGATCAATCTTTTTCTCTCTTTGTGAATGGGGGGATGAAGATCCTGCAACTTGGGCCAAGTCTATTGGGAACAGTTGGAGAACAACTGGAGATATTTCTGATAA...

CDS

Download CDS FASTA

786 bp · TkAUNG012380|TK1151|CDS

ATGAAAATGCCAGGATCACTAGGACATGAAGAACAAGATGCTAAAACTTTTGCCTCCTGGGGGGTTGATTACTTGAAGTATGACAATTGTAACAACAACGGTATCAGTCCAAAGGAAAGGTATCCCGTGATGGCAAAAGCTTTACTGAATTCTGGGAGATCAATCTTTTTCTCTCTTTGTGAATGGGGGGATGAAGATCCTGCAACTTGGGCCAAGTCTATTGGGAACAGTTGGAGAACAACTGGAGATATTTCTGATAA...

Protein

Download Protein FASTA

261 aa · TkAUNG012380|TK1151|PROTEIN

MKMPGSLGHEEQDAKTFASWGVDYLKYDNCNNNGISPKERYPVMAKALLNSGRSIFFSLCEWGDEDPATWAKSIGNSWRTTGDISDNWDSMTSRADLNDKWAAYAGPGGWNDPDMLEVGNGGMSTEEYRSHFSIWALAKAPLLIGCDIRSMDNVTLGLLSNTEVIAVNQDKLGIQGKKIKKDGDLEVWGGPLNGNRVAVILWNRGSSTATITAYWSDLGIDSKTAVDARDLWAHSTQKSVKGQISASVASHDCKMYVLSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG012380`
TK1151 ID	TkAUNG012380
OH-1004 ID	LXL04_012767
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	73.700
Protein coverage (%)	TK1151 99.234 / OH-1004 64.589 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG012380

Location ChrUn:3058223-3059769 (-)

Description Similar to Alpha-galactosidase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g08370`	May regulate leaf (and possibly other organ) development by functioning in cell wall loosening and cell wall expansion.	An alpha-galactosidase with an essential function during leaf development.2007 · DOI: 10.1007/s00425-006-0350-9
`At5g08380`	May regulate leaf (and possibly other organ) development by functioning in cell wall loosening and cell wall expansion.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0493600`	Hydrolyzes melibiose, raffinose and stachyose in the following decreasing order of reactivity: raffinose, melibiose, stachyose.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012767 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0009620 response to fungus Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0009965 leaf morphogenesis Biological Process

GO:0051682 galactomannan catabolic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0009505 plant-type cell wall Cellular Component

GO:0048046 apoplast Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0004557 alpha-galactosidase activity Molecular Function

GO:0052692 raffinose alpha-galactosidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G08370

ath:AT5G08380

dosa:Os10g0493600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.938

Rank 1 · TkAUNG012380 · TK1151

Cytoplasm0.037

Rank 2 · TkAUNG012380 · TK1151

Cell membrane0.016

Rank 3 · TkAUNG012380 · TK1151

Lysosome / Vacuole0.014

Rank 4 · TkAUNG012380 · TK1151

Endoplasmic reticulum0.011

Rank 5 · TkAUNG012380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16499Melibiase_23-170 aa

PF24880DUF773868-89 aa

PF17801Melibiase_C73-88 aa

PF17801Melibiase_C161-177 aa

PF24880DUF7738165-225 aa

PF17450Melibiase_2_C173-238 aa

PF17801Melibiase_C182-258 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG012380	`PF16499`	Melibiase_2	3	170	3e-42	145.6
TkAUNG012380	`PF24880`	DUF7738	68	89	0.27	12.5
TkAUNG012380	`PF17801`	Melibiase_C	73	88	1.6e-20	73.6
TkAUNG012380	`PF17801`	Melibiase_C	161	177	1.6e-20	73.6
TkAUNG012380	`PF24880`	DUF7738	165	225	0.27	12.5
TkAUNG012380	`PF17450`	Melibiase_2_C	173	238	1.7e-05	25.6
TkAUNG012380	`PF17801`	Melibiase_C	182	258	1.6e-20	73.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RX86`	Arabidopsis thaliana	sp\|Q8RX86\|AGAL2_ARATH Alpha-galactosidase 2	72.400%	Swiss-Prot	High
`Q9FT97`	Arabidopsis thaliana	sp\|Q9FT97\|AGAL1_ARATH Alpha-galactosidase 1	58.100%	Swiss-Prot	High
`Q9FXT4`	Oryza sativa subsp. japonica	sp\|Q9FXT4\|AGAL_ORYSJ Alpha-galactosidase	67.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card