RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G139560
Reference: TK1151 Chr: Chr08 Coordinates: 36283857-36288240 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1105 bp · TkA08G139560|TK1151|cDNA

AGAGAGTTGACTAAAAGAACTCAAGTTTATATATTGCTAAGCAATATTGGATGCAATTATAGCCCTATTTAGCTTCAATTATTTGGAACTCTAAACCTTATTTCCTCTTGTTAATTGATCGATTATCAAAACTATGGCTCTCCTAAAACAATTCGAATACCTTCAAATACAACTACAGGACATACTATCAGCAACTAACAGCTTCGATGAAGACTACAGCATAGGGGAAGGCGGATTTGGGAAAATCTACAAAGCAGAAC...

CDS

Download CDS FASTA

2205 bp · TkA08G139560|TK1151|CDS

ATGGCTCTCCTAAAACAATTCGAATACCTTCAAATACAACTACAGGACATACTATCAGCAACTAACAGCTTCGATGAAGACTACAGCATAGGGGAAGGCGGATTTGGGAAAATCTACAAAGCAGAACTCCTCCTTTCCAAGGAGCATACAACCACTGCTATAAAACGTTTAGATCGTAAACGTGGGCAAGGAGACTCCGAATTTTGGAAGGAGGTTATGATGCTCTCAGTTTATAAGCATGAAAATATTGTCTCCCTCTT...

Protein

Download Protein FASTA

734 aa · TkA08G139560|TK1151|PROTEIN

MALLKQFEYLQIQLQDILSATNSFDEDYSIGEGGFGKIYKAELLLSKEHTTTAIKRLDRKRGQGDSEFWKEVMMLSVYKHENIVSLLGFCDEKDEKILVYKYEPNRSLESHLCNNSLTWARRLNICIGAARGLAYLHDPGETQQRILHRDIKSANILLDENWNARITDFGLSKYGPANQKYTFIVSNNIAGTMGYCDPVYFQTGILTKESDIYSFGVVLFEILCGRLCLGVKDKTQSFVQSVRTHYKQNKLDEIVWVNMK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G139560
TK1151 IDTkA08G139560
OH-1004 IDLXL04_031976
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 93.188 / OH-1004 93.188
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G139560
LocationChr08:36283857-36288240 (+)
DescriptionSimilar to HERK1: Receptor-like protein kinase HERK 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g46290 Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.
Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
At5g59700 Probable receptor-like protein kinase At5g59700. No verified direct reference in this release
At1g30570 Probable receptor-like protein kinase At1g30570. No verified direct reference in this release
At5g39000 Putative receptor-like protein kinase At5g39000. No verified direct reference in this release
At5g54380 Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.
A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis.2007 · DOI: 10.1016/j.cub.2007.05.018
Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_031976 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009611 response to wounding Biological Process
GO:0009617 response to bacterium Biological Process
GO:0009741 response to brassinosteroid Biological Process
GO:0009826 unidimensional cell growth Biological Process
GO:0010183 pollen tube guidance Biological Process
GO:0010483 pollen tube reception Biological Process
GO:0071395 cellular response to jasmonic acid stimulus Biological Process
GO:0071446 cellular response to salicylic acid stimulus Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009506 plasmodesma Cellular Component
KEGG gene cross-reference
ath:AT2G32800
ath:AT3G46290
ath:AT5G59700
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.512
Rank 1 · TkA08G139560 · TK1151
Cell membrane0.370
Rank 2 · TkA08G139560 · TK1151
Nucleus0.249
Rank 3 · TkA08G139560 · TK1151
Endoplasmic reticulum0.050
Rank 4 · TkA08G139560 · TK1151
Golgi apparatus0.046
Rank 5 · TkA08G139560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase27-294 aa
PF07714PK_Tyr_Ser-Thr29-296 aa
PF07718Coatamer_beta_C76-91 aa
PF01636APH139-177 aa
PF12330Haspin_kinase140-180 aa
PF03109ABC1143-181 aa
PF16677GP3_package152-180 aa
PF07718Coatamer_beta_C186-212 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G139560PF00069Pkinase272946.4e-86288.7
TkA08G139560PF07714PK_Tyr_Ser-Thr292962.6e-85286.6
TkA08G139560PF07718Coatamer_beta_C76910.1512.7
TkA08G139560PF01636APH1391771.9e-0628.5
TkA08G139560PF12330Haspin_kinase1401800.0002820.7
TkA08G139560PF03109ABC11431810.001718.3
TkA08G139560PF16677GP3_package1521800.2412.2
TkA08G139560PF07718Coatamer_beta_C1862120.1512.7
TkA08G139560PF12330Haspin_kinase2723940.0002820.7
TkA08G139560PF00069Pkinase3806476.4e-86288.7
TkA08G139560PF07714PK_Tyr_Ser-Thr3816502.6e-85286.6
TkA08G139560PF01636APH4925151.9e-0628.5
TkA08G139560PF03109ABC14965340.001718.3
TkA08G139560PF12330Haspin_kinase5015410.0002820.7
TkA08G139560PF16677GP3_package5055340.2412.2
TkA08G139560PF07718Coatamer_beta_C5395640.1512.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LX66Arabidopsis thalianasp|Q9LX66|HERK_ARATH Receptor-like protein kinase HERK 144.600%Swiss-ProtMedium
Q9FN92Arabidopsis thalianasp|Q9FN92|Y5597_ARATH Probable receptor-like protein kinase At5g5970044.600%Swiss-ProtMedium
Q9SA72Arabidopsis thalianasp|Q9SA72|Y1357_ARATH Probable receptor-like protein kinase At1g3057044.700%Swiss-ProtMedium
Q9FID8Arabidopsis thalianasp|Q9FID8|Y5900_ARATH Putative receptor-like protein kinase At5g3900042.300%Swiss-ProtMedium
Q9LK35Arabidopsis thalianasp|Q9LK35|THE1_ARATH Receptor-like protein kinase THESEUS 144.900%Swiss-ProtMedium

JBrowse

View in Genome Browser