TkA08G074050 | RubberDandelionOmics

Gene overview

TkA08G074050

Reference: TK1151 Chr: Chr08 Coordinates: 19094575-19097120 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1676 bp · TkA08G074050|TK1151|cDNA

GTTAAGCACAACTAGAACTGGTTCCAAAATTATTCTAATTCCAAAAACGGATACATGGTGTGTTGATGATCACCCCTATACGGGCCCTATGGACACACGTTCAGATTATCACGTTGTTGATTTTATTATGGAAAGAAAAGCAAGTGAGGGAAATTGACCTATTTACGTGACATATTTATGCAACAAATGAAGCCTAAATTTTCTCTCCCTTCAAAATATTTTTTAAAATATTTTTGCGTTTTAAATTGCATTCTCCAGTT...

CDS

Download CDS FASTA

987 bp · TkA08G074050|TK1151|CDS

ATGGGCAGAGTAACACGGTGGTTGAAGGGGTTGTTAGGTATCAGAAAATCAAAAGATTCCGGCGACCGGAAAGACACCACTACGTCATGTGTCGGCCTCTCACGTAGAGACCCCACCATTTCTCCGCCAGTTTACAAAACCCAGTCGGAGGAAGAACAGAATAAGCATGCAATTGCAGTTGCTGCCGCCGCCGCTGACGCCGCCGTTGCTTCCGCCCAAGCAGCTGTCGCCGTCGTTAAGCTCACTAGCCAGTGCGGTTT...

Protein

Download Protein FASTA

328 aa · TkA08G074050|TK1151|PROTEIN

MGRVTRWLKGLLGIRKSKDSGDRKDTTTSCVGLSRRDPTISPPVYKTQSEEEQNKHAIAVAAAAADAAVASAQAAVAVVKLTSQCGFAGGGREASAAVKIQSVFRGYLSRKALRALKGLVKLQALMRGYMVRKQAAATLRSMEALVRAQSSVCAQKYHAMNRLQDSKERFDDTRSDYTSIHSRRFSGSFEPFQNEESPKIVEIDPGPVRSKSRSRRANTWVWAPAYSDNPYAQHVSVSSPHRHQSPVRLPIPSSQTHEFE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G074050`
TK1151 ID	TkA08G074050
OH-1004 ID	LXL04_002485
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	45.400
Protein coverage (%)	TK1151 99.390 / OH-1004 90.411 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G074050

Location Chr08:19094575-19097120 (-)

Description Similar to IQD20: Protein IQ-DOMAIN 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16490`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At4g29150`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At1g51960`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At5g62070`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At5g03040`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002485 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010091 trichome branching Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT1G51960

ath:AT3G16490

ath:AT4G00820

ath:AT4G14750

ath:AT4G29150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.404

Rank 1 · TkA08G074050 · TK1151

Cell membrane0.374

Rank 2 · TkA08G074050 · TK1151

Nucleus0.372

Rank 3 · TkA08G074050 · TK1151

Endoplasmic reticulum0.052

Rank 4 · TkA08G074050 · TK1151

Plastid0.040

Rank 5 · TkA08G074050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00612IQ95-114 aa

PF26038Dimer_MINDY4_N101-114 aa

PF00612IQ120-134 aa

PF26038Dimer_MINDY4_N123-144 aa

PF13178DUF4005137-151 aa

PF13178DUF4005274-312 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G074050	`PF00612`	IQ	95	114	8.9e-11	41.3
TkA08G074050	`PF26038`	Dimer_MINDY4_N	101	114	0.14	13.4
TkA08G074050	`PF00612`	IQ	120	134	8.9e-11	41.3
TkA08G074050	`PF26038`	Dimer_MINDY4_N	123	144	0.14	13.4
TkA08G074050	`PF13178`	DUF4005	137	151	3.1e-07	31.7
TkA08G074050	`PF13178`	DUF4005	274	312	3.1e-07	31.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LK76`	Arabidopsis thaliana	sp\|Q9LK76\|IQD26_ARATH Protein IQ-domain 26	45.200%	Swiss-Prot	Medium
`F4JMV6`	Arabidopsis thaliana	sp\|F4JMV6\|IQD25_ARATH Protein IQ-DOMAIN 25	42.600%	Swiss-Prot	Medium
`Q9ZU28`	Arabidopsis thaliana	sp\|Q9ZU28\|IQD27_ARATH Protein IQ-DOMAIN 27	38.300%	Swiss-Prot	Medium
`Q9FIT1`	Arabidopsis thaliana	sp\|Q9FIT1\|IQD23_ARATH Protein IQ-DOMAIN 23	30.800%	Swiss-Prot	Medium
`Q93ZH7`	Arabidopsis thaliana	sp\|Q93ZH7\|IQD2_ARATH Protein IQ-DOMAIN 2	41.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card