TkA06G377070 | RubberDandelionOmics

Gene overview

TkA06G377070

Reference: TK1151 Chr: Chr06 Coordinates: 93390746-93394140 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1537 bp · TkA06G377070|TK1151|cDNA

TGCATACGGTATATGTTCATCATTGTGATGTAATCGCATAATATGGATTTAGTTTCTTTTTAATGGGAAACGAATCAAAATGATGGTCACAATTGGTGCACACCTAATTCCTCCAGGACACCACCACCCCCATTCTGCCATTATATCAGTCTGAGTTGGCCTTTCAGAAGTCAAAGTGTCAAACACCCACACACACTATATATATATACCCTAATACCTCCATATCAAACCCAAAATAGAGCTCACGAACAATTACATGA...

CDS

Download CDS FASTA

972 bp · TkA06G377070|TK1151|CDS

ATGAACAAATTGTTACAATCGACTATCGTAACTCATCTTACATCACGATTGACGGTGTTTTCCGGCAGAAATAACAGCAAATTCGCCATGACCACCACGTCGGAGGCTGTTGGGTTCAGTGCGCCGAGATTGGTGACGAAGAAGGTTTTGGCGAAGAGACAGAGCGAAGGAGATGGTGCTGTTGTTCGGAGAAGCATCGGAAGGCCGGAGTTGAAGTCTCTGGATCCATTCCTCATGTTAGACGAATTTTCTGTTTCTGC...

Protein

Download Protein FASTA

323 aa · TkA06G377070|TK1151|PROTEIN

MNKLLQSTIVTHLTSRLTVFSGRNNSKFAMTTTSEAVGFSAPRLVTKKVLAKRQSEGDGAVVRRSIGRPELKSLDPFLMLDEFSVSAPAGFPDHPHRGFETVTYMLEGAFTHQDFSGHKGTIRAGDVQWMTAGRGIIHSEMPAATGVQKGLQLWINLSSKDKMVEPNYQELLREDIQTVERDGVKVTIIAGESMGVKSPVYTRTPTMFLDFTLDPGSQTHQPVPESWNSFVYVIEGEGVFGSMDSKPVSAHHVLVLGQGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G377070`
TK1151 ID	TkA06G377070
OH-1004 ID	LXL04_023260
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G377070

Location Chr06:93390746-93394140 (-)

Description Similar to Pirin-like protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43120`	Involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum.	PIRIN2 stabilizes cysteine protease XCP2 and increases susceptibility to the vascular pathogen Ralstonia solanacearum in Arabidopsis.2014 · DOI: 10.1111/tpj.12602
`At3g59220`	Involved in abscisic acid signal transduction.	The GCR1, GPA1, PRN1, NF-Y signal chain mediates both blue light and abscisic acid responses in Arabidopsis.2007 · DOI: 10.1104/pp.106.089904
`At1g50590`	Pirin-like protein At1g50590.	No verified direct reference in this release
`At3g59260`	Putative pirin-like protein At3g59260.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023260 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009785 blue light signaling pathway Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0030414 peptidase inhibitor activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G50590

ath:AT2G43120

ath:AT3G59220

ath:AT3G59260

sly:543607

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.388

Rank 1 · TkA06G377070 · TK1151

Cytoplasm0.315

Rank 2 · TkA06G377070 · TK1151

Peroxisome0.188

Rank 3 · TkA06G377070 · TK1151

Nucleus0.124

Rank 4 · TkA06G377070 · TK1151

Plastid0.119

Rank 5 · TkA06G377070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02678Pirin62-155 aa

PF05899Cupin_388-133 aa

PF07883Cupin_290-133 aa

PF05726Pirin_C96-132 aa

PF05726Pirin_C174-195 aa

PF07883Cupin_2178-197 aa

PF05899Cupin_3182-192 aa

PF05726Pirin_C209-312 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G377070	`PF02678`	Pirin	62	155	1.9e-33	115.4
TkA06G377070	`PF05899`	Cupin_3	88	133	0.02	15.3
TkA06G377070	`PF07883`	Cupin_2	90	133	4.5e-07	30.2
TkA06G377070	`PF05726`	Pirin_C	96	132	1.2e-35	122.7
TkA06G377070	`PF05726`	Pirin_C	174	195	1.2e-35	122.7
TkA06G377070	`PF07883`	Cupin_2	178	197	4.5e-07	30.2
TkA06G377070	`PF05899`	Cupin_3	182	192	0.02	15.3
TkA06G377070	`PF05726`	Pirin_C	209	312	1.2e-35	122.7
TkA06G377070	`PF07883`	Cupin_2	211	277	4.5e-07	30.2
TkA06G377070	`PF05899`	Cupin_3	226	248	0.02	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZW82`	Arabidopsis thaliana	sp\|Q9ZW82\|PRNL2_ARATH Pirin-like protein 2	73.400%	Swiss-Prot	High
`Q9LX49`	Arabidopsis thaliana	sp\|Q9LX49\|PRN1_ARATH Pirin-1	66.900%	Swiss-Prot	High
`Q9LPS9`	Arabidopsis thaliana	sp\|Q9LPS9\|PRNL1_ARATH Pirin-like protein At1g50590	61.200%	Swiss-Prot	High
`Q9LX45`	Arabidopsis thaliana	sp\|Q9LX45\|PRNL4_ARATH Putative pirin-like protein At3g59260	64.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card