TkA06G117380 | RubberDandelionOmics

Gene overview

TkA06G117380

Reference: TK1151 Chr: Chr06 Coordinates: 30733377-30735675 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1447 bp · TkA06G117380|TK1151|cDNA

CTGAACTTGAATCAAAAAATTCAAATAGAGAGCCTCCACTCCAGCCCTCCAGCTCCATCGGCGACTCCACTCTATCCCTCGTCCGCGACTCCAACTCCTCCACCTCTTGTCGCCGGCGCCGACTCCGGCTTCAACAAGGTCGCACCACCGCTGCAGCAGGCTCCATCTTCGAACAGAAACCGTGAACCCAGAAACTACTTAGACGACAAACAAAATGGCTTTCACTCTTGAAGTCCCGATGAATCTACTTGGAAGACAAC...

CDS

Download CDS FASTA

1035 bp · TkA06G117380|TK1151|CDS

ATGGCTTTCACTCTTGAAGTCCCGATGAATCTACTTGGAAGACAACAACAACAACATCTCGCATCATTCTCAAAGAGCAAACCCCCATCAAAACTCACTCCCTTCACCAAAAAACAACACCACTCTTCATTCTCAATATCAGCCACACTAAACACAACAATCCAGAGCCTCGATGACACCCATTTATCTCAATCGAAAAACCTCGCTCTCCCAATCATGGTCAATAGCTGTATGGGGAAGATGGGCCAGGCAGTAGTTGA...

Protein

Download Protein FASTA

344 aa · TkA06G117380|TK1151|PROTEIN

MAFTLEVPMNLLGRQQQQHLASFSKSKPPSKLTPFTKKQHHSSFSISATLNTTIQSLDDTHLSQSKNLALPIMVNSCMGKMGQAVVEAGISAGLHIVPASFGIQQDAGKTIEVGGKDILVHGPSEREATLASILEQYPDLIIVDFTVPNAVNDNAELYCKTGVPFVMGTTGGDRDLLYKTVEESKLYAVISPQMGKQVVAFLAAMDIMSKQFPGAFSGYTLEVLESHQSTKLDTSGTAKAVISCFQKLGVSFDLDEVQLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G117380`
TK1151 ID	TkA06G117380
OH-1004 ID	LXL04_024687
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 94.231 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G117380

Location Chr06:30733377-30735675 (-)

Description Similar to DAPB2: 4-hydroxy-tetrahydrodipicolinate reductase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59890`	Catalyzes the conversion of 4-hydroxy-tetrahydrodipicolinate (HTPA) to tetrahydrodipicolinate.	No verified direct reference in this release
`At2g44040`	Catalyzes the conversion of 4-hydroxy-tetrahydrodipicolinate (HTPA) to tetrahydrodipicolinate.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0436400`	Catalyzes the conversion of 4-hydroxy-tetrahydrodipicolinate (HTPA) to tetrahydrodipicolinate.	No verified direct reference in this release
`Os03g0245100`	Catalyzes the conversion of 4-hydroxy-tetrahydrodipicolinate (HTPA) to tetrahydrodipicolinate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024687 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009089 L-lysine biosynthetic process via diaminopimelate Biological Process

GO:0019877 diaminopimelate biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0008839 4-hydroxy-tetrahydrodipicolinate reductase activity Molecular Function

GO:0016726 oxidoreductase activity, acting on CH or CH2 groups, NAD or NADP as acceptor Molecular Function

GO:0050661 NADP binding Molecular Function

GO:0051287 NAD binding Molecular Function

GO:0070402 NADPH binding Molecular Function

KEGG gene cross-reference

ath:AT2G44040

ath:AT3G59890

dosa:Os02g0436400

dosa:Os03g0245100

mst:Msp_0109

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.979

Rank 1 · TkA06G117380 · TK1151

Cytoplasm0.037

Rank 2 · TkA06G117380 · TK1151

Mitochondrion0.036

Rank 3 · TkA06G117380 · TK1151

Peroxisome0.024

Rank 4 · TkA06G117380 · TK1151

Nucleus0.022

Rank 5 · TkA06G117380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01113DapB_N71-194 aa

PF05173DapB_C198-338 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G117380	`PF01113`	DapB_N	71	194	3.4e-16	60.2
TkA06G117380	`PF05173`	DapB_C	198	338	7.4e-16	59.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LB01`	Arabidopsis thaliana	sp\|Q8LB01\|DAPB2_ARATH 4-hydroxy-tetrahydrodipicolinate reductase 2, chloroplastic	77.100%	Swiss-Prot	High
`O80574`	Arabidopsis thaliana	sp\|O80574\|DAPB1_ARATH 4-hydroxy-tetrahydrodipicolinate reductase 1, chloroplastic	74.200%	Swiss-Prot	High
`Q67W29`	Oryza sativa subsp. japonica	sp\|Q67W29\|DAPB1_ORYSJ Probable 4-hydroxy-tetrahydrodipicolinate reductase 1, chloroplastic	69.700%	Swiss-Prot	High
`Q10P67`	Oryza sativa subsp. japonica	sp\|Q10P67\|DAPB2_ORYSJ Probable 4-hydroxy-tetrahydrodipicolinate reductase 2, chloroplastic	67.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card