TkA06G037240 | RubberDandelionOmics

Gene overview

TkA06G037240

Reference: TK1151 Chr: Chr06 Coordinates: 9994244-9999592 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3969 bp · TkA06G037240|TK1151|cDNA

CAAAAACATTGGTTGCCAAATTGAATGGTTTTTCAAAAACTCCGCAACCTTCTTTTAACTCCTGATGCGAACCGGCCGAAGTCATAAACTCATAACTTATACGCAACTTAGCACGGCAGTTCCATCCGTCTGCAACCACCCATTTCACAGGCTACGGCGGCTTCATCCTCTCAACCGTGTGGATCTCGGTATCACTCTCATCCCGGGTTTGACTTGCAATGACTAAAGTCAAGAAAGCACCACAAAGATCCGGATCAAAG...

CDS

Download CDS FASTA

1626 bp · TkA06G037240|TK1151|CDS

ATGACTGCTTTCACGAGTAGCCGCAACAAGCGTAACGCAGAATTTCAATTTTCGTCACCGTCTGCTTTCGGTTATGCGTATGGTCACCCTCACACTTCGAAGAAGCTCAAACAATCGTTTTGCTATTCGAATTTGATTGATACAAAGGAGAGTTCGGTTTCGAGAGCGCTTAGTCGATATCCGCCGCCGGTGACCCCGATTTTTAGACAGCCTCATGGTCCTTGTATAGTTGCTAAGGGATTTATCGCAAACTCGAGTAG...

Protein

Download Protein FASTA

541 aa · TkA06G037240|TK1151|PROTEIN

MTAFTSSRNKRNAEFQFSSPSAFGYAYGHPHTSKKLKQSFCYSNLIDTKESSVSRALSRYPPPVTPIFRQPHGPCIVAKGFIANSSRLDSSCSGYIRQQPGSFVGRMGNFFRAKYDRWKEALFGSRRPVKFEKEDVIDVDHTQTVDDENAGSGDSDVEEVAMVETEREDIDKSGELQGIIAKYIELDEDDEENPAFQPSTSSGVVSQSTDGNTLESLSLNQKPDDSDVDASLTVVKTLESLSLNQRPTYSDVDAIPYHKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G037240`
TK1151 ID	TkA06G037240
OH-1004 ID	LXL04_025945
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G037240

Location Chr06:9994244-9999592 (-)

Description Similar to ESD4: Ubiquitin-like-specific protease ESD4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15880`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	A nuclear protease required for flowering-time regulation in Arabidopsis reduces the abundance of SMALL UBIQUITIN-RELATED MODIFIER conjugates.2003 · DOI: 10.1105/tpc.015487
`At3g06910`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	No verified direct reference in this release
`At4g00690`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025945 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0016925 protein sumoylation Biological Process

GO:0016926 protein desumoylation Biological Process

GO:0032435 negative regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0043488 regulation of mRNA stability Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0061157 mRNA destabilization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G06910

ath:AT4G00690

ath:AT4G15880

hsa:29843

mmu:223870

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.717

Rank 1 · TkA06G037240 · TK1151

Cytoplasm0.317

Rank 2 · TkA06G037240 · TK1151

Mitochondrion0.070

Rank 3 · TkA06G037240 · TK1151

Cell membrane0.037

Rank 4 · TkA06G037240 · TK1151

Endoplasmic reticulum0.023

Rank 5 · TkA06G037240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06400Alpha-2-MRAP_N173-183 aa

PF24319DUF7491262-317 aa

PF06400Alpha-2-MRAP_N268-305 aa

PF02902Peptidase_C48353-536 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G037240	`PF06400`	Alpha-2-MRAP_N	173	183	0.82	10.5
TkA06G037240	`PF24319`	DUF7491	262	317	0.069	14.1
TkA06G037240	`PF06400`	Alpha-2-MRAP_N	268	305	0.82	10.5
TkA06G037240	`PF02902`	Peptidase_C48	353	536	6.9e-45	154.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94F30`	Arabidopsis thaliana	sp\|Q94F30\|ESD4_ARATH Ubiquitin-like-specific protease ESD4	43.000%	Swiss-Prot	Medium
`Q8GYL3`	Arabidopsis thaliana	sp\|Q8GYL3\|ULP1A_ARATH Ubiquitin-like-specific protease 1A	40.300%	Swiss-Prot	Medium
`O65278`	Arabidopsis thaliana	sp\|O65278\|ULP1B_ARATH Putative ubiquitin-like-specific protease 1B	59.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card