TkA03G586440 | RubberDandelionOmics

Gene overview

TkA03G586440

Reference: TK1151 Chr: Chr03 Coordinates: 149010575-149013159 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2477 bp · TkA03G586440|TK1151|cDNA

GAATTCTGATTTTCAATTTACTTTCAAAGACTAAAAAAGTCATAAAATATAAATAGCGAGAAAAAAAGTTCTTATCAGCCTACTCCCACACTACGCATCCACCAATCTGTGCAAATCGCATCCCGACTTCTGTCAAGAACACGACGGAGCAACAAACGAAGAAGCTTCAATCGGACCAAACATCACCAACAATCCTCTTCCTGTTGCTTCCGTTGTAATCAAAACAAATGAATTATATTCCTCCTCATCTTCTCACTAAT...

CDS

Download CDS FASTA

1611 bp · TkA03G586440|TK1151|CDS

ATGGTCCGGAGTCGACTCACCTTCACAGCTCGACTGGCTCGGCATCTACACACCCCCCAACTCCTCGCTCCACGAATTCATCGGCTATCTCTACCTAAAAACACCTCATCCACGTGGGAATCCGGGTCGGGTTCCATCACAGTCCCGTTAATTAACCTTAGATCCAAATACAAGATCCGGATCTTCCGATGGACAGATTCAGAAGTCATCCCGACCCGACACGATCACGACGGCAACCCCTTACCACAACCCAAACATTT...

Protein

Download Protein FASTA

536 aa · TkA03G586440|TK1151|PROTEIN

MVRSRLTFTARLARHLHTPQLLAPRIHRLSLPKNTSSTWESGSGSITVPLINLRSKYKIRIFRWTDSEVIPTRHDHDGNPLPQPKHLLAETEEFQYEQVHASDQIHLALTGEVGEMRVMFVTGHGKESVVKYGLDSGRMNQVVGTRVGRYEREDMCDSPANQTVGWRDPGFIHDGVMINLQPGRRYFYKVGSDSEGWSNTFSFVSPDNNSGETIAFLYGDMGTATPYTTYVRTQDESISTIKLIARDIEAIGDKPALISH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G586440`
TK1151 ID	TkA03G586440
OH-1004 ID	LXL04_011412
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.800
Protein coverage (%)	TK1151 92.724 / OH-1004 76.110 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G586440

Location Chr03:149010575-149013159 (-)

Description Similar to PAP2: Probable inactive purple acid phosphatase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13900`	Probable inactive purple acid phosphatase 2.	No verified direct reference in this release
`At2g03450`	Probable inactive purple acid phosphatase 9.	No verified direct reference in this release
`At1g13750`	Probable inactive purple acid phosphatase 1.	No verified direct reference in this release
`At5g50400`	Probable inactive purple acid phosphatase 27.	No verified direct reference in this release
`At4g24890`	Probable inactive purple acid phosphatase 24.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011412 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006109 regulation of carbohydrate metabolic process Biological Process

GO:0006626 protein targeting to mitochondrion Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0045040 protein insertion into mitochondrial outer membrane Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005740 mitochondrial envelope Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G13750

ath:AT1G13900

ath:AT2G03450

ath:AT4G24890

ath:AT5G50400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.456

Rank 1 · TkA03G586440 · TK1151

Extracellular0.258

Rank 2 · TkA03G586440 · TK1151

Cytoplasm0.138

Rank 3 · TkA03G586440 · TK1151

Endoplasmic reticulum0.114

Rank 4 · TkA03G586440 · TK1151

Cell membrane0.111

Rank 5 · TkA03G586440 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14008Metallophos_C91-105 aa

PF16656Pur_ac_phosph_N103-204 aa

PF00149Metallophos240-444 aa

PF14008Metallophos_C295-314 aa

PF24459DUF7574295-330 aa

PF14008Metallophos_C458-526 aa

PF00149Metallophos514-521 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G586440	`PF14008`	Metallophos_C	91	105	4.4e-16	60.0
TkA03G586440	`PF16656`	Pur_ac_phosph_N	103	204	8.3e-18	65.5
TkA03G586440	`PF00149`	Metallophos	240	444	1.5e-13	52.3
TkA03G586440	`PF14008`	Metallophos_C	295	314	4.4e-16	60.0
TkA03G586440	`PF24459`	DUF7574	295	330	0.14	13.0
TkA03G586440	`PF14008`	Metallophos_C	458	526	4.4e-16	60.0
TkA03G586440	`PF00149`	Metallophos	514	521	1.5e-13	52.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMG7`	Arabidopsis thaliana	sp\|Q9LMG7\|PPA2_ARATH Probable inactive purple acid phosphatase 2	67.700%	Swiss-Prot	High
`Q9ZQ81`	Arabidopsis thaliana	sp\|Q9ZQ81\|PPA9_ARATH Probable inactive purple acid phosphatase 9	65.700%	Swiss-Prot	High
`Q9LMX4`	Arabidopsis thaliana	sp\|Q9LMX4\|PPA1_ARATH Probable inactive purple acid phosphatase 1	33.300%	Swiss-Prot	Medium
`Q5MAU8`	Arabidopsis thaliana	sp\|Q5MAU8\|PPA27_ARATH Probable inactive purple acid phosphatase 27	33.000%	Swiss-Prot	Medium
`Q8H1R2`	Arabidopsis thaliana	sp\|Q8H1R2\|PPA24_ARATH Probable inactive purple acid phosphatase 24	30.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card