TkA03G566850 | RubberDandelionOmics

Gene overview

TkA03G566850

Reference: TK1151 Chr: Chr03 Coordinates: 143837479-143840213 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1824 bp · TkA03G566850|TK1151|cDNA

CGACCACAGCTATGTGGCTATGTAATGCAAGCAAATTGGGCCTTTGGTAATTCCTCAAAACATAAATCCACTGGAAACTTGGATCCAGTAACTTCTATTTTGATAATCGCCCCCCTGGTTTCCCCAATCCTCCACTTCTGGGAAACAAATTTTCGTCTCGTAATCTCAAAATCCAATCCCATCTCCCATCAGGGTTTTGTTAGTGCGACTGATTTCGAAGAGAAGTATCGACGATGGAGGGTGGCGTGGTTCTTTCTGCG...

CDS

Download CDS FASTA

1377 bp · TkA03G566850|TK1151|CDS

ATGGAGGGTGGCGTGGTTCTTTCTGCGACCGACCAGCAAAATATGGTCTCTTTGTTTCTTGAAATTGCTGTCGGTCAGACTGCCGAAACCGCAAGGCAGTTTTTACAGGCCACAAGCTGGAAACTCGAAGAAGCTATTCAACTTTTTTACATCGGGAATGAAGGTGGAGCGGCTGCATCATCGTCTCCCTATGTTCCACCGCTAGAAAACGATGGGCTTTTGCCAGACCAAAACATTGGAGGTTCGGAGAACAACAACAT...

Protein

Download Protein FASTA

458 aa · TkA03G566850|TK1151|PROTEIN

MEGGVVLSATDQQNMVSLFLEIAVGQTAETARQFLQATSWKLEEAIQLFYIGNEGGAAASSSPYVPPLENDGLLPDQNIGGSENNNIGSKNATEDDSNEVRAPLPVKRDVLYDTPMLFGATRIGYTPHEARTLVPFRNFEDELKHPGVWETEQGATSTTDTSRDNLATLYRPPFGLMYLGSFEKAKESAKNQDRWLLVNLQSTREFSSHMLNRDTWANEAVSQTIMSNFIFWQVCDDTEDGSKIKTYYKLDSVPVTLVID...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G566850`
TK1151 ID	TkA03G566850
OH-1004 ID	LXL04_011124
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G566850

Location Chr03:143837479-143840213 (+)

Description Similar to PUX7: Plant UBX domain-containing protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14570`	Acts as a bridge between CDC48A and ubiquitin, suggesting a role in targeted protein degradation.	Functional characterization of the plant ubiquitin regulatory X (UBX) domain-containing protein AtPUX7 in Arabidopsis thaliana.2013 · DOI: 10.1016/j.gene.2013.05.056
`At4g14250`	Putative plant UBX domain-containing protein 14.	No verified direct reference in this release
`At4g14245`	Plant UBX domain-containing protein 16.	No verified direct reference in this release
`At1g59550`	Putative plant UBX domain-containing protein 15.	No verified direct reference in this release
`At3g23605`	Plant UBX domain-containing protein 12.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011124 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0030674 protein-macromolecule adaptor activity Molecular Function

GO:0043130 ubiquitin binding Molecular Function

KEGG gene cross-reference

ath:AT1G14570

ath:AT1G59550

spo:2541532

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.512

Rank 1 · TkA03G566850 · TK1151

Nucleus0.498

Rank 2 · TkA03G566850 · TK1151

Cell membrane0.078

Rank 3 · TkA03G566850 · TK1151

Endoplasmic reticulum0.075

Rank 4 · TkA03G566850 · TK1151

Golgi apparatus0.057

Rank 5 · TkA03G566850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22566UBA_811-54 aa

PF14555UBA_414-52 aa

PF21021FAF1179-233 aa

PF13899Thioredoxin_7181-261 aa

PF13098Thioredoxin_2183-282 aa

PF21021FAF1248-284 aa

PF00789UBX380-437 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G566850	`PF22566`	UBA_8	11	54	0.00024	21.6
TkA03G566850	`PF14555`	UBA_4	14	52	2.8e-10	40.5
TkA03G566850	`PF21021`	FAF1	179	233	0.35	11.3
TkA03G566850	`PF13899`	Thioredoxin_7	181	261	1.7e-14	54.4
TkA03G566850	`PF13098`	Thioredoxin_2	183	282	1.1e-05	26.4
TkA03G566850	`PF21021`	FAF1	248	284	0.35	11.3
TkA03G566850	`PF00789`	UBX	380	437	1.2e-08	35.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94JZ8`	Arabidopsis thaliana	sp\|Q94JZ8\|PUX7_ARATH Plant UBX domain-containing protein 7	54.200%	Swiss-Prot	High
`P0DKI4`	Arabidopsis thaliana	sp\|P0DKI4\|PUX14_ARATH Putative plant UBX domain-containing protein 14	40.800%	Swiss-Prot	Medium
`P0DKI5`	Arabidopsis thaliana	sp\|P0DKI5\|PUX16_ARATH Plant UBX domain-containing protein 16	33.800%	Swiss-Prot	Medium
`Q94HV8`	Arabidopsis thaliana	sp\|Q94HV8\|PUX15_ARATH Putative plant UBX domain-containing protein 15	40.400%	Swiss-Prot	Medium
`Q9LUG7`	Arabidopsis thaliana	sp\|Q9LUG7\|PUX12_ARATH Plant UBX domain-containing protein 12	49.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card