TkA03G564840 | RubberDandelionOmics

Gene overview

TkA03G564840

Reference: TK1151 Chr: Chr03 Coordinates: 143304434-143308066 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2399 bp · TkA03G564840|TK1151|cDNA

GCATAAATAGGCTTTGCTCTTGCTCCCATCAGTCGTCACCCTGTGCACCTCCCGCACTATCCGCACTAGCTATATATATCCAATTCGAACTCCACTACAACATACACACTCACACAGTATATTCTACCTGTCAATTCGATCACTAATCAAATCAATAATGGGCAGCGTCGGTGAATCGGAGAAGTATTTGCTGAATCGGCACCAGGAGAACCACTTCACCGCCGGTGAAATTGTTCGTGACATCATCATCGGGGTTTCCG...

CDS

Download CDS FASTA

723 bp · TkA03G564840|TK1151|CDS

ATGGGCAGCGTCGGTGAATCGGAGAAGTATTTGCTGAATCGGCACCAGGAGAACCACTTCACCGCCGGTGAAATTGTTCGTGACATCATCATCGGGGTTTCCGATGGCCTTACCGTTCCATTCGCACTCGCGGCTGGGCTTTCCGGTGCTAATGCTTCGTCTTCTATCATCCTCACCGCCGGCATAGCTGAGGTTGCTGCTGGTGCTATCTCGATGGGACTCGGCGGGTATTTGGCGGCCAAAAGTGAGGCAGATCATTA...

Protein

Download Protein FASTA

240 aa · TkA03G564840|TK1151|PROTEIN

MGSVGESEKYLLNRHQENHFTAGEIVRDIIIGVSDGLTVPFALAAGLSGANASSSIILTAGIAEVAAGAISMGLGGYLAAKSEADHYARELQREQDEIDTIPDTEAAEVAEILAEYGVEPHEYGPVVNALRKNPKAWLDFMMKFELGLEKPDPKRALQSALTIAIAYVLGGLVPLSPYMFIPIAQKAMFASVIVTIFALLVFGFAKGYFTGDRPVWSALQTALIGAIASAAAFGLAKVVQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G564840`
TK1151 ID	TkA03G564840
OH-1004 ID	LXL04_003607
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	87.500
Protein coverage (%)	TK1151 13.333 / OH-1004 13.389 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G564840

Location Chr03:143304434-143308066 (-)

Description Similar to BPA1: Binding partner of ACD11 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g01770`	Vacuolar iron transporter involved in the transfer of iron ions from the cytosol to the vacuole for intracellular iron storage.	Localization of iron in Arabidopsis seed requires the vacuolar membrane transporter VIT1.2006 · DOI: 10.1126/science.1132563 Identification of the endodermal vacuole as the iron storage compartment in the Arabidopsis embryo.2009 · DOI: 10.1104/pp.109.144444 Bypassing Iron Storage in Endodermal Vacuoles Rescues the Iron Mobilization Defect in the natural resistance associated-macrophage protein3natural resistance associated-macrophage protein4 Double Mutant.2015 · DOI: 10.1104/pp.15.00380

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0396900`	Vacuolar iron transporter involved in the transfer of iron ions from the cytosol to the vacuole for intracellular iron storage.	Vacuolar membrane transporters OsVIT1 and OsVIT2 modulate iron translocation between flag leaves and seeds in rice.2012 · DOI: 10.1111/j.1365-313x.2012.05088.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003607 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006826 iron ion transport Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0030026 intracellular manganese ion homeostasis Biological Process

GO:0034051 negative regulation of plant-type hypersensitive response Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0005381 iron ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT5G16840

dosa:Os04g0463400

egr:104453645

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.462

Rank 1 · TkA03G564840 · TK1151

Golgi apparatus0.217

Rank 2 · TkA03G564840 · TK1151

Cytoplasm0.205

Rank 3 · TkA03G564840 · TK1151

Endoplasmic reticulum0.196

Rank 4 · TkA03G564840 · TK1151

Cell membrane0.156

Rank 5 · TkA03G564840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01988VIT126-236 aa

PF19942DUF640454-54 aa

PF19942DUF6404107-129 aa

PF19942DUF6404174-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G564840	`PF01988`	VIT1	26	236	1.1e-74	251.6
TkA03G564840	`PF19942`	DUF6404	54	54	6.1	8.0
TkA03G564840	`PF19942`	DUF6404	107	129	6.1	8.0
TkA03G564840	`PF19942`	DUF6404	174	229	6.1	8.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUA5`	Arabidopsis thaliana	sp\|Q9ZUA5\|VIT1_ARATH Vacuolar iron transporter 1	79.000%	Swiss-Prot	High
`Q6ERE5`	Oryza sativa subsp. japonica	sp\|Q6ERE5\|VIT2_ORYSJ Vacuolar iron transporter 2	76.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card