TkA03G376140 | RubberDandelionOmics

Gene overview

TkA03G376140

Reference: TK1151 Chr: Chr03 Coordinates: 92828743-92837974 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5040 bp · TkA03G376140|TK1151|cDNA

AAACAAAGTTCACCAACCGCATATTTCCACAGTAAAAAGACAGAAAGGTGATGTATTAAAATAACTTAAAACTTAATCCTCCAAACACTTGCAAATATTATATGGTGAGCCGACTATATAAATAGATGTACCATTGACACTATCAGCGAACACGAAGCCAAAGACATAGTCACCCTGACCTTTTCACAACACAATGGTCCTTCTCCCTCCTTTCAACCCTTCACCAACCACCTCCGCCACCATAAAACTCCGATAACCTG...

CDS

Download CDS FASTA

4503 bp · TkA03G376140|TK1151|CDS

ATGGAAGAAGCGAGAGCCAGGGGTTCAGTAAGGCGAAGTGCCAGCCGGACGATGAGCAGGAACCGGAGTACGGCGAGGTGGGGTATGGAAGACGTTTTCGCCGCCGGCAGCGGTGGCAGCTACAACCGGCGGTCTAGTCGGCACTCGGAGGAAGACGAAGAAGCGCTCCGGTGGGCTGCTTTGGAAAAACTACCGACTTACGACCGATTAAGAACCACCATCATGAAGTCTTATACAAACGACGACGAAAACCAGCGGCA...

Protein

Download Protein FASTA

1500 aa · TkA03G376140|TK1151|PROTEIN

MEEARARGSVRRSASRTMSRNRSTARWGMEDVFAAGSGGSYNRRSSRHSEEDEEALRWAALEKLPTYDRLRTTIMKSYTNDDENQRQRASVLHKEIDVRKLDPNERQEFIDRIFKVAEEDNEKFLRKFRNRIDKVGITLPTVEVRFEHLTIEADCHIGDRALPSLANAARNLIEYGLGCVGIGLAEKTKLTILKDASGIIKPSRMALLLGPPSSGKTTLLLALAGKLDPSLKVKGEITYNGHKLTEFVPRKTSAYISQND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G376140`
TK1151 ID	TkA03G376140
OH-1004 ID	LXL04_008409
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G376140

Location Chr03:92828743-92837974 (+)

Description Similar to ABCG36: ABC transporter G family member 36

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g59870`	Together with ABCG37, regulates auxin homeostasis and responses by playing a dual role in coumarin (e.g. esculin) and in the auxin precursor indole 3-butyric acid (IBA) efflux transport, thus influencing cotyledons, roots and root hairs development.	Loss of AtPDR8, a plasma membrane ABC transporter of Arabidopsis thaliana, causes hypersensitive cell death upon pathogen infection.2006 · DOI: 10.1093/pcp/pcj001 Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration.2006 · DOI: 10.1105/tpc.105.038372 The ABC transporter AtPDR8 is a cadmium extrusion pump conferring heavy metal resistance.2007 · DOI: 10.1111/j.1365-313x.2007.03044.x Extracellular transport and integration of plant secretory proteins into pathogen-induced cell wall compartments.2009 · DOI: 10.1111/j.1365-313x.2008.03743.x Glucosinolate metabolites required for an Arabidopsis innate immune response.2009 · DOI: 10.1126/science.1164627 The Arabidopsis PLEIOTROPIC DRUG RESISTANCE8/ABCG36 ATP binding cassette transporter modulates sensitivity to the auxin precursor indole-3-butyric acid.2009 · DOI: 10.1105/tpc.109.065821 Overexpression of AtABCG36 improves drought and salt stress resistance in Arabidopsis.2010 · DOI: 10.1111/j.1399-3054.2010.01353.x Arabidopsis PIS1 encodes the ABCG37 transporter of auxinic compounds including the auxin precursor indole-3-butyric acid.2010 · DOI: 10.1073/pnas.1005878107 Induction and suppression of PEN3 focal accumulation during Pseudomonas syringae pv. tomato DC3000 infection of Arabidopsis.2013 · DOI: 10.1094/mpmi-11-12-0262-r Role of the penetration-resistance genes PEN1, PEN2 and PEN3 in the hypersensitive response and race-specific resistance in Arabidopsis thaliana.2014 · DOI: 10.1111/tpj.12571 Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways.2015 · DOI: 10.1104/pp.15.00182 ABC transporter PEN3/PDR8/ABCG36 interacts with calmodulin that, like PEN3, is required for Arabidopsis nonhost resistance.2016 · DOI: 10.1111/nph.13582 An Arabidopsis Lipid Flippase Is Required for Timely Recruitment of Defenses to the Host-Pathogen Interface at the Plant Cell Surface.2017 · DOI: 10.1016/j.molp.2017.04.003 Arabidopsis Transporter ABCG37/PDR9 contributes primarily highly oxygenated Coumarins to Root Exudation.2017 · DOI: 10.1038/s41598-017-03250-6 Expression analysis of transporter genes for screening candidate monolignol transporters using Arabidopsis thaliana cell suspensions during tracheary element differentiation.2018 · DOI: 10.1007/s10265-017-0979-4 Arabidopsis BTB/POZ protein-dependent PENETRATION3 trafficking and disease susceptibility.2017 · DOI: 10.1038/s41477-017-0039-z
`At1g15210`	May be a general defense protein.	No verified direct reference in this release
`At3g16340`	May be a general defense protein.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0554800`	May be a general defense protein.	No verified direct reference in this release
`Os01g0724500`	May be a general defense protein.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008409 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002229 defense response to oomycetes Biological Process

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0002238 response to molecule of fungal origin Biological Process

GO:0002239 response to oomycetes Biological Process

GO:0002240 response to molecule of oomycetes origin Biological Process

GO:0009408 response to heat Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009620 response to fungus Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0009651 response to salt stress Biological Process

KEGG gene cross-reference

ath:AT1G15210

ath:AT1G59870

ath:AT3G16340

dosa:Os01g0724500

dosa:Os06g0554800

osa:4324722

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.764

Rank 1 · TkA03G376140 · TK1151

Endoplasmic reticulum0.128

Rank 2 · TkA03G376140 · TK1151

Cytoplasm0.106

Rank 3 · TkA03G376140 · TK1151

Lysosome / Vacuole0.062

Rank 4 · TkA03G376140 · TK1151

Golgi apparatus0.050

Rank 5 · TkA03G376140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070MSC6_N62-133 aa

PF20720nSTAND371-110 aa

PF13401AAA_2272-122 aa

PF13476AAA_2376-123 aa

PF16238DUF489777-193 aa

PF19993DO-GTPase282-120 aa

PF13207AAA_1798-134 aa

PF14510ABC_trans_N117-168 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G376140	`PF29070`	MSC6_N	62	133	0.037	13.8
TkA03G376140	`PF20720`	nSTAND3	71	110	0.21	12.0
TkA03G376140	`PF13401`	AAA_22	72	122	0.0024	18.9
TkA03G376140	`PF13476`	AAA_23	76	123	0.064	14.6
TkA03G376140	`PF16238`	DUF4897	77	193	0.029	14.9
TkA03G376140	`PF19993`	DO-GTPase2	82	120	0.56	10.6
TkA03G376140	`PF13207`	AAA_17	98	134	1.1	10.3
TkA03G376140	`PF14510`	ABC_trans_N	117	168	1.8e-08	35.4
TkA03G376140	`PF00005`	ABC_tran	193	374	3.7e-38	131.9
TkA03G376140	`PF20720`	nSTAND3	193	226	0.21	12.0
TkA03G376140	`PF13481`	AAA_25	198	224	0.0034	17.8
TkA03G376140	`PF02367`	TsaE	198	228	0.43	11.3
TkA03G376140	`PF03193`	RsgA_GTPase	200	228	0.016	15.7
TkA03G376140	`PF13555`	AAA_29	201	231	3.7e-05	24.1
TkA03G376140	`PF03215`	Rad17	201	232	0.023	15.3
TkA03G376140	`PF13191`	AAA_16	202	230	0.0002	22.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XIE2`	Arabidopsis thaliana	sp\|Q9XIE2\|AB36G_ARATH ABC transporter G family member 36	71.900%	Swiss-Prot	High
`Q7PC86`	Arabidopsis thaliana	sp\|Q7PC86\|AB35G_ARATH ABC transporter G family member 35	70.900%	Swiss-Prot	High
`Q94A18`	Arabidopsis thaliana	sp\|Q94A18\|AB29G_ARATH ABC transporter G family member 29	69.800%	Swiss-Prot	High
`Q5Z9S8`	Oryza sativa subsp. japonica	sp\|Q5Z9S8\|AB42G_ORYSJ ABC transporter G family member 42	72.100%	Swiss-Prot	High
`Q7FMW4`	Oryza sativa subsp. japonica	sp\|Q7FMW4\|AB38G_ORYSJ ABC transporter G family member 38	67.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card