TkA01G616010 | RubberDandelionOmics

Gene overview

TkA01G616010

Reference: TK1151 Chr: Chr01 Coordinates: 155405585-155408522 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2190 bp · TkA01G616010|TK1151|cDNA

AAAGATCGCATGAGAACAGTCCACGAAGCAGCGTTGAGCCATTGACCCCCCCAAACTCATTATCAATAATGGCTGAGCTGTTCAGACCTTGGAAAATTCCTACTTTCATCGTCTTCTTCAATCCCCCTCCAAACCGTTCCATTTATTGTTCCCTTCTCATTCACCTCTCTGATCATCCAACATTCTTCCTTCTTTTTTGCAAAACTCCGTCAAATTTTATTTTCGTAGATCACCAATCTCAGGTTGCTGACCAAAAAAGA...

CDS

Download CDS FASTA

1596 bp · TkA01G616010|TK1151|CDS

ATGGGTAATTGCTGTGCTGTACCCTCTACCACCGATACTGAGTTCGAGAAGAAAAAGGGGAAGAACAAACCGAACCCATTTTCTCTAGACAATGGTGGTTCAATTCCATCTGGTAATGGATATAAATCGTATGTGTTAGAAAACCCAACAGGACATGAAATTGAGGAAACGTATGTTCTTGGTAAGGAGCTGGGTAGAGGAGAATTCGGCGTTACTTACATGTGTACCGATAAGTCAACTGGTGAAATTTTTGCCTGTAA...

Protein

Download Protein FASTA

531 aa · TkA01G616010|TK1151|PROTEIN

MGNCCAVPSTTDTEFEKKKGKNKPNPFSLDNGGSIPSGNGYKSYVLENPTGHEIEETYVLGKELGRGEFGVTYMCTDKSTGEIFACKSISKKKLRTRVDIEDVRREVEIMKHMPSHPNIVCLKDTYEDDSAVHLVMEVCEGGELFDRIVARGHYTERAAAGVTRTIVEVIQMCHKHGVMHRDLKPENFLFANKKETAALKAIDFGLSVFFKPGERFNEIVGSPYYMAPEVLKRNYGPEVDVWSAGVILYILLCGVPPFWA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G616010`
TK1151 ID	TkA01G616010
OH-1004 ID	LXL04_000381
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G616010

Location Chr01:155405585-155408522 (+)

Description Similar to CPK7: Calcium-dependent protein kinase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g12480`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At5g19450`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At3g57530`	May play a role in signal transduction pathways that involve calcium as a second messenger.	Arabidopsis calcium-dependent protein kinase AtCPK32 interacts with ABF4, a transcriptional regulator of abscisic acid-responsive gene expression, and modulates its activity.2005 · DOI: 10.1104/pp.105.069757
`At2g41860`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0568600`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000381 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0004698 calcium,diacylglycerol-dependent serine/threonine kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G41860

ath:AT3G57530

ath:AT5G12480

ath:AT5G19450

dosa:Os07g0568600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.601

Rank 1 · TkA01G616010 · TK1151

Cytoplasm0.341

Rank 2 · TkA01G616010 · TK1151

Nucleus0.221

Rank 3 · TkA01G616010 · TK1151

Golgi apparatus0.054

Rank 4 · TkA01G616010 · TK1151

Endoplasmic reticulum0.050

Rank 5 · TkA01G616010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14531Kinase-like54-107 aa

PF00069Pkinase58-316 aa

PF07714PK_Tyr_Ser-Thr60-311 aa

PF03109ABC1133-215 aa

PF06293Kdo133-204 aa

PF14531Kinase-like150-302 aa

PF17667Pkinase_fungal172-240 aa

PF29176Allatotropin-like_C266-280 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G616010	`PF14531`	Kinase-like	54	107	2.5e-07	31.0
TkA01G616010	`PF00069`	Pkinase	58	316	4e-81	273.0
TkA01G616010	`PF07714`	PK_Tyr_Ser-Thr	60	311	3.2e-26	92.9
TkA01G616010	`PF03109`	ABC1	133	215	1.4e-05	25.1
TkA01G616010	`PF06293`	Kdo	133	204	0.00031	21.0
TkA01G616010	`PF14531`	Kinase-like	150	302	2.5e-07	31.0
TkA01G616010	`PF17667`	Pkinase_fungal	172	240	0.12	11.8
TkA01G616010	`PF29176`	Allatotropin-like_C	266	280	0.27	11.6
TkA01G616010	`PF29176`	Allatotropin-like_C	287	309	0.27	11.6
TkA01G616010	`PF10591`	SPARC_Ca_bdg	345	383	0.0041	18.1
TkA01G616010	`PF13833`	EF-hand_8	347	364	3.5e-13	49.8
TkA01G616010	`PF25825`	SAPC2_N	357	422	7.7e-09	36.0
TkA01G616010	`PF21008`	AIF-1	359	423	0.00016	22.7
TkA01G616010	`PF25578`	EF-hand_STIM1	361	384	0.06	14.2
TkA01G616010	`PF08976`	EF-hand_11	361	422	0.18	13.4
TkA01G616010	`PF13499`	EF-hand_7	364	422	1.9e-25	89.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38873`	Arabidopsis thaliana	sp\|Q38873\|CDPK7_ARATH Calcium-dependent protein kinase 7	78.400%	Swiss-Prot	High
`Q42438`	Arabidopsis thaliana	sp\|Q42438\|CDPK8_ARATH Calcium-dependent protein kinase 8	78.800%	Swiss-Prot	High
`Q6NLQ6`	Arabidopsis thaliana	sp\|Q6NLQ6\|CDPKW_ARATH Calcium-dependent protein kinase 32	77.300%	Swiss-Prot	High
`P93759`	Arabidopsis thaliana	sp\|P93759\|CDPKE_ARATH Calcium-dependent protein kinase 14	74.400%	Swiss-Prot	High
`Q84SL0`	Oryza sativa subsp. japonica	sp\|Q84SL0\|CDPKK_ORYSJ Calcium-dependent protein kinase 20	74.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card