TkA01G119700 | RubberDandelionOmics

Gene overview

TkA01G119700

Reference: TK1151 Chr: Chr01 Coordinates: 30334529-30335894 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1275 bp · TkA01G119700|TK1151|cDNA

AAAAAACGTTAAAGCAAAAAACAATAAAAACAATTGTTTGTGCATTTTGAATCCTATAAATTAGCTTCTCCAGTTCACTTGTAACACACAATCGCACATTCGCACTATGGACGCTTTGCCCAACAGATTAGAAGGCAAAGTAGCCATAGTTACCGGCGGTGCTAGTGGCATCGGTGAAAGCACGGTGAGGCTGTTCGTTAAATATGGCGCCAAAGTGGTGATAGCAGACATACAAGATGACCTAGGAGTTACTCTTTGTA...

CDS

Download CDS FASTA

831 bp · TkA01G119700|TK1151|CDS

ATGGACGCTTTGCCCAACAGATTAGAAGGCAAAGTAGCCATAGTTACCGGCGGTGCTAGTGGCATCGGTGAAAGCACGGTGAGGCTGTTCGTTAAATATGGCGCCAAAGTGGTGATAGCAGACATACAAGATGACCTAGGAGTTACTCTTTGTAACGATCTAGTGTCTGAAAATGTTTTTTACGTTCATTGTGACGTTACTCAAGAATCCGACGTGAAGAATGCTGTTGATACAGCTGTTTCCATGTTCGGGAAGCTTGA...

Protein

Download Protein FASTA

276 aa · TkA01G119700|TK1151|PROTEIN

MDALPNRLEGKVAIVTGGASGIGESTVRLFVKYGAKVVIADIQDDLGVTLCNDLVSENVFYVHCDVTQESDVKNAVDTAVSMFGKLDIMFNNAGIPGNLDFKILESDNENFKRVFDVNTFGSFLGAKHAARVMIPAKRGVILFTSSVASVVSGESPHSYTVSKHAVVGLMKNLCVELGQYGIRVNCISPGSVSTPLLTNAMGLEKAAVDGILCASAVLKEVVPTAEDIGEAAVYLGSDASKFVSGINLVVDGGYSTTNPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G119700`
TK1151 ID	TkA01G119700
OH-1004 ID	LXL04_004711
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.200
Protein coverage (%)	TK1151 95.652 / OH-1004 83.544 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G119700

Location Chr01:30334529-30335894 (-)

Description Similar to Secoisolariciresinol dehydrogenase (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0179200`	Involved in momilactone phytoalexins biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004711 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009411 response to UV Biological Process

GO:0009611 response to wounding Biological Process

GO:0009699 phenylpropanoid biosynthetic process Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009807 lignan biosynthetic process Biological Process

GO:0016114 terpenoid biosynthetic process Biological Process

GO:0051289 protein homotetramerization Biological Process

GO:0000166 nucleotide binding Molecular Function

GO:0004022 alcohol dehydrogenase (NAD+) activity Molecular Function

GO:0102960 momilactone-A synthase [NAD(P)H] activity Molecular Function

GO:0120529 secoisolariciresinol dehydrogenase activity Molecular Function

KEGG gene cross-reference

ag:AAK38664

ag:ABN14311

dosa:Os04g0179200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.759

Rank 1 · TkA01G119700 · TK1151

Nucleus0.330

Rank 2 · TkA01G119700 · TK1151

Peroxisome0.112

Rank 3 · TkA01G119700 · TK1151

Mitochondrion0.062

Rank 4 · TkA01G119700 · TK1151

Plastid0.032

Rank 5 · TkA01G119700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short11-199 aa

PF05368NmrA13-83 aa

PF08659KR14-169 aa

PF010733Beta_HSD14-79 aa

PF01370Epimerase14-78 aa

PF13561adh_short_C219-255 aa

PF18479PIN_1142-108 aa

PF23441SDR60-253 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G119700	`PF00106`	adh_short	11	199	6.6e-53	179.8
TkA01G119700	`PF05368`	NmrA	13	83	0.11	12.8
TkA01G119700	`PF08659`	KR	14	169	3.9e-08	34.1
TkA01G119700	`PF01073`	3Beta_HSD	14	79	0.00041	20.2
TkA01G119700	`PF01370`	Epimerase	14	78	0.15	12.2
TkA01G119700	`PF13561`	adh_short_C2	19	255	2e-61	208.3
TkA01G119700	`PF18479`	PIN_11	42	108	0.057	14.4
TkA01G119700	`PF23441`	SDR	60	253	5.6e-08	33.2
TkA01G119700	`PF01370`	Epimerase	158	176	0.15	12.2
TkA01G119700	`PF05368`	NmrA	219	256	0.11	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7FAE1`	Oryza sativa subsp. japonica	sp\|Q7FAE1\|MOMAS_ORYSJ Momilactone A synthase	54.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card