LXL04_037081 | RubberDandelionOmics

Gene overview

LXL04_037081

Reference: OH-1004 Chr: Chr08 Coordinates: 52824811-52828205 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1695 bp · LXL04_037081|LXL04_037081|OH1004|cDNA

ATGCAAACCAACAAACTCATTCCCTTTCTTCTCTCTGCCCTTTTCTTGTTTGCGTTTTTCATTTTTTCCATTCCCAAAATTATAAACCACCACCACTCACTTCCGCTATTTACACAAAATACACCTCTACACTTACACCTTCACAAACGCATCCAAACACAAACAGCGTATACACATTGCCACGGTTCCCTATACTACGACCTCTGTCATGAAACCCTCACCACCGTTCTACCGGACCTCCGATCAAAATCTCTCCCAGA...

CDS

Download CDS FASTA

1695 bp · LXL04_037081|LXL04_037081|OH1004|CDS

ATGCAAACCAACAAACTCATTCCCTTTCTTCTCTCTGCCCTTTTCTTGTTTGCGTTTTTCATTTTTTCCATTCCCAAAATTATAAACCACCACCACTCACTTCCGCTATTTACACAAAATACACCTCTACACTTACACCTTCACAAACGCATCCAAACACAAACAGCGTATACACATTGCCACGGTTCCCTATACTACGACCTCTGTCATGAAACCCTCACCACCGTTCTACCGGACCTCCGATCAAAATCTCTCCCAGA...

Protein

Download Protein FASTA

564 aa · LXL04_037081|LXL04_037081|OH1004|PROTEIN

MQTNKLIPFLLSALFLFAFFIFSIPKIINHHHSLPLFTQNTPLHLHLHKRIQTQTAYTHCHGSLYYDLCHETLTTVLPDLRSKSLPEIITATINQTVNDVKSTDFNVTAIRRKLRNLNALEIRALDDCHSLFLETVSELTSAISVLNTTPYNKHNDLQTLLSASMTNQATCLDGFSFSKSRNKIRRYFHKSVRNISRQVSNSLALLKKMNGASKRKAEAFPEYGEMAGGYPRWVKKKERALLQAPVNETSYNLVVAKDGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037081`
TK1151 ID	TkA04G005200
OH-1004 ID	LXL04_037081
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037081

Location Chr08:52824811-52828205 (+)

Description Similar to PME40: Probable pectinesterase/pectinesterase inhibitor 40

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02320`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At4g02300`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At1g53830`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037081 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0042545 cell wall modification Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0050829 defense response to Gram-negative bacterium Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0004857 enzyme inhibitor activity Molecular Function

GO:0030599 pectinesterase activity Molecular Function

GO:0046910 pectinesterase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT1G53830

ath:AT4G02300

ath:AT4G02320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.369

Rank 1 · LXL04_037081 · OH-1004

Cell membrane0.225

Rank 2 · LXL04_037081 · OH-1004

Endoplasmic reticulum0.130

Rank 3 · LXL04_037081 · OH-1004

Lysosome / Vacuole0.127

Rank 4 · LXL04_037081 · OH-1004

Cytoplasm0.119

Rank 5 · LXL04_037081 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04043.21PMEI58-205 aa

PF01095.26Pectinesterase252-548 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037081	`PF04043.21`	PMEI	58	205	6e-24	85.7
LXL04_037081	`PF01095.26`	Pectinesterase	252	548	1.5e-140	467.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81301`	Arabidopsis thaliana	Probable pectinesterase/pectinesterase inhibitor 40	53.144%	Swiss-Prot	strong database homology
`O81415`	Arabidopsis thaliana	Probable pectinesterase/pectinesterase inhibitor 39	52.857%	Swiss-Prot	strong database homology
`Q42534`	Arabidopsis thaliana	Pectinesterase 2	47.243%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card