LXL04_036870 | RubberDandelionOmics

Gene overview

LXL04_036870

Reference: OH-1004 Chr: Chr08 Coordinates: 49520335-49521531 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1197 bp · LXL04_036870|LXL04_036870|OH1004|cDNA

ATGGCCAATCCTCCCACCACCTCACGCGCCACTACTTATCCCGCCTCCAAACGCCGCAGACATTCCGATGATCACCATCATCCTCTGCTTCCTGGGCTGCCGGATCAAATAGCCCTACTGTGCCTCTCACTCGTCTCTCAGGCCGCTTTATATTCCGTTTGCCGGTCATGGCGCCGCCTCGTCTACTCTGCCTCCATCCCACCTTTCCGATCACTTTACACTCTCTCTATACCCACAGCCGCCGCCTGCGACGGTGGTGG...

CDS

Download CDS FASTA

1197 bp · LXL04_036870|LXL04_036870|OH1004|CDS

ATGGCCAATCCTCCCACCACCTCACGCGCCACTACTTATCCCGCCTCCAAACGCCGCAGACATTCCGATGATCACCATCATCCTCTGCTTCCTGGGCTGCCGGATCAAATAGCCCTACTGTGCCTCTCACTCGTCTCTCAGGCCGCTTTATATTCCGTTTGCCGGTCATGGCGCCGCCTCGTCTACTCTGCCTCCATCCCACCTTTCCGATCACTTTACACTCTCTCTATACCCACAGCCGCCGCCTGCGACGGTGGTGG...

Protein

Download Protein FASTA

398 aa · LXL04_036870|LXL04_036870|OH1004|PROTEIN

MANPPTTSRATTYPASKRRRHSDDHHHPLLPGLPDQIALLCLSLVSQAALYSVCRSWRRLVYSASIPPFRSLYTLSIPTAAACDGGGVDHQMLRLFSFDPISSKWITVDPPPLPPFIHRVSLRHPSFISRYLPVQSLSVSGKLVLIAGTSGDLLPALTHPLVFNPVSNAWSAGPPISTPRRWCAVGASRGTVVVASGIGSHYTQTVARSVEKWVLKKTESLHKKRIETDEVWEKMRSLRYSKLCREAIDAVGWRGKLCMV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036870`
TK1151 ID	TkA04G019760
OH-1004 ID	LXL04_036870
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 77.136 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036870

Location Chr08:49520335-49521531 (+)

Description Similar to SKIP25: F-box/kelch-repeat protein SKIP25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31350`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At1g55270`	F-box/kelch-repeat protein At1g55270.	No verified direct reference in this release
`At2g24540`	Component of SCF (ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	No verified direct reference in this release
`At4g39590`	F-box/kelch-repeat protein At4g39590.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036870 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009585 red, far-red light phototransduction Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:2000762 regulation of phenylpropanoid metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G31350

ath:AT1G55270

ath:AT2G24540

ath:AT4G39590

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.894

Rank 1 · LXL04_036870 · OH-1004

Cytoplasm0.143

Rank 2 · LXL04_036870 · OH-1004

Cell membrane0.037

Rank 3 · LXL04_036870 · OH-1004

Endoplasmic reticulum0.035

Rank 4 · LXL04_036870 · OH-1004

Plastid0.019

Rank 5 · LXL04_036870 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GX29`	Arabidopsis thaliana	F-box/kelch-repeat protein SKIP25	48.082%	Swiss-Prot	moderate database homology
`Q93W93`	Arabidopsis thaliana	F-box/kelch-repeat protein At1g55270	23.467%	Swiss-Prot	weak database homology
`Q8LAW2`	Arabidopsis thaliana	F-box protein AFR	23.631%	Swiss-Prot	weak database homology
`Q1PE10`	Arabidopsis thaliana	F-box/kelch-repeat protein At4g39590	25.356%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card