LXL04_036111 | RubberDandelionOmics

Gene overview

LXL04_036111

Reference: OH-1004 Chr: Chr08 Coordinates: 35892240-35894135 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1620 bp · LXL04_036111|LXL04_036111|OH1004|cDNA

ATGAGAATTCAATCTTCATACTGGCTTCTGTTCCTATACTTTTTCGCAAGCTTTTTTAGGTTACATCCAACACTAGTTTCAGGTCAATGTCTCGATAACCAGAAATCCTTGCTGTTATCGTTGAAAAACGAGCTCAAATTCGACTCTTCACTCTCAACAAAGCTCGTCGGATGGAACCAAAGTGGCGACTGCTGCGGTTGGGGTGGTGTGACCTGTGACAAATCCGGTCATGTCATCGGACTTGATCTTAATCACGAAAG...

CDS

Download CDS FASTA

1620 bp · LXL04_036111|LXL04_036111|OH1004|CDS

ATGAGAATTCAATCTTCATACTGGCTTCTGTTCCTATACTTTTTCGCAAGCTTTTTTAGGTTACATCCAACACTAGTTTCAGGTCAATGTCTCGATAACCAGAAATCCTTGCTGTTATCGTTGAAAAACGAGCTCAAATTCGACTCTTCACTCTCAACAAAGCTCGTCGGATGGAACCAAAGTGGCGACTGCTGCGGTTGGGGTGGTGTGACCTGTGACAAATCCGGTCATGTCATCGGACTTGATCTTAATCACGAAAG...

Protein

Download Protein FASTA

539 aa · LXL04_036111|LXL04_036111|OH1004|PROTEIN

MRIQSSYWLLFLYFFASFFRLHPTLVSGQCLDNQKSLLLSLKNELKFDSSLSTKLVGWNQSGDCCGWGGVTCDKSGHVIGLDLNHESISGGFNGSSSLFRLKNLSVILLDENTLSSQIPESFANFQNLTVLSLRACNLSGPLPKKIFQGSRNLASLNLYQNNLTGGIPSFQGVNSLQFLDLSYNSLTGDFPESLLTLPSIEYVYLSNNRLSGQISGKGIVVSSYKIRNLDLSRNKFEGPIPEFIFKLPVLSTLMLSENNF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036111`
TK1151 ID	TkA04G074520
OH-1004 ID	LXL04_036111
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.900
Protein coverage (%)	TK1151 96.853 / OH-1004 51.391 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036111

Location Chr08:35892240-35894135 (+)

Description Similar to IRK: Probable LRR receptor-like serine/threonine-protein kinase IRK

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g56370`	Probable LRR receptor-like serine/threonine-protein kinase IRK.	No verified direct reference in this release
`At4g13810`	Receptor-like protein 47.	No verified direct reference in this release
`At4g13880`	Plays a role in root hair development.	Uncovering genes and ploidy involved in the high diversity in root hair density, length and response to local scarce phosphate in Arabidopsis thaliana.2015 · DOI: 10.1371/journal.pone.0120604
`At2g33050`	Receptor like protein 26.	No verified direct reference in this release
`At2g33060`	Receptor like protein 27.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036111 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0048364 root development Biological Process

GO:0048767 root hair elongation Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0090511 periclinal cell division Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G56370

ath:AT4G13810

ath:AT4G13880

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.817

Rank 1 · LXL04_036111 · OH-1004

Endoplasmic reticulum0.109

Rank 2 · LXL04_036111 · OH-1004

Cytoplasm0.066

Rank 3 · LXL04_036111 · OH-1004

Nucleus0.049

Rank 4 · LXL04_036111 · OH-1004

Extracellular0.040

Rank 5 · LXL04_036111 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_232-73 aa

PF23598.2LRR_14100-285 aa

PF13855.13LRR_8127-177 aa

PF13855.13LRR_8169-210 aa

PF12799.14LRR_4175-210 aa

PF13855.13LRR_8226-285 aa

PF23598.2LRR_14436-500 aa

PF12799.14LRR_4442-477 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036111	`PF08263.18`	LRRNT_2	32	73	2.1e-08	35.0
LXL04_036111	`PF23598.2`	LRR_14	100	285	4.6e-18	65.8
LXL04_036111	`PF13855.13`	LRR_8	127	177	8e-33	112.7
LXL04_036111	`PF13855.13`	LRR_8	169	210	8e-33	112.7
LXL04_036111	`PF12799.14`	LRR_4	175	210	6.2e-21	74.7
LXL04_036111	`PF13855.13`	LRR_8	226	285	8e-33	112.7
LXL04_036111	`PF23598.2`	LRR_14	436	500	4.6e-18	65.8
LXL04_036111	`PF12799.14`	LRR_4	442	477	6.2e-21	74.7
LXL04_036111	`PF13855.13`	LRR_8	443	501	8e-33	112.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LY03`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase IRK	33.271%	Swiss-Prot	moderate database homology
`Q9SVN2`	Arabidopsis thaliana	Receptor-like protein 47	32.258%	Swiss-Prot	moderate database homology
`F4JTU7`	Arabidopsis thaliana	Receptor-like protein 48	30.427%	Swiss-Prot	moderate database homology
`O49328`	Arabidopsis thaliana	Receptor like protein 26	34.302%	Swiss-Prot	moderate database homology
`F4IUU1`	Arabidopsis thaliana	Receptor like protein 27	34.933%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card