LXL04_034631 | RubberDandelionOmics

Gene overview

LXL04_034631

Reference: OH-1004 Chr: Chr07 Coordinates: 111409873-111411135 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

516 bp · LXL04_034631|LXL04_034631|OH1004|cDNA

ATGTCTCCAGAATATGCAATGAATGGTCATTATTCGGTGAAATCAGATGTTTACAGCTTCGGTGTTATAGTGCTGGAAATTTTCAGCAGCCAGAAAAATTGGTCCTTTCATCATCCTGATCACGATCTTAACCTATTAGGGCATACTTGGATGCTTTGGAACAAAAGACAACCGTTGGATATACTAGACCCCACGGTACAAGATCCATCTTGTGGGAATCAAGTTAAAAGATGCATCCACGTTGCCCTTTTATGTGTGCA...

CDS

Download CDS FASTA

516 bp · LXL04_034631|LXL04_034631|OH1004|CDS

ATGTCTCCAGAATATGCAATGAATGGTCATTATTCGGTGAAATCAGATGTTTACAGCTTCGGTGTTATAGTGCTGGAAATTTTCAGCAGCCAGAAAAATTGGTCCTTTCATCATCCTGATCACGATCTTAACCTATTAGGGCATACTTGGATGCTTTGGAACAAAAGACAACCGTTGGATATACTAGACCCCACGGTACAAGATCCATCTTGTGGGAATCAAGTTAAAAGATGCATCCACGTTGCCCTTTTATGTGTGCA...

Protein

Download Protein FASTA

171 aa · LXL04_034631|LXL04_034631|OH1004|PROTEIN

MSPEYAMNGHYSVKSDVYSFGVIVLEIFSSQKNWSFHHPDHDLNLLGHTWMLWNKRQPLDILDPTVQDPSCGNQVKRCIHVALLCVQQYPEDRPKVSTVYAMLGYENIELPEPKEPGFCRESYRKKADTPVTESSTVNEVTMHDDLEWTLKSSIQILVYHLYFYLLICIST

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034631`
TK1151 ID	TkA08G414430
OH-1004 ID	LXL04_034631
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.200
Protein coverage (%)	TK1151 95.946 / OH-1004 83.041 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034631

Location Chr07:111409873-111411135 (+)

Description Similar to CRK8: Cysteine-rich receptor-like protein kinase 8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23160`	Cysteine-rich receptor-like protein kinase 8.	No verified direct reference in this release
`At4g23140`	Cysteine-rich receptor-like protein kinase 6.	No verified direct reference in this release
`At4g21380`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release
`At4g23180`	Cysteine-rich receptor-like protein kinase 10.	No verified direct reference in this release
`At1g65790`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034631 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006955 immune response Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0007165 signal transduction Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0071215 cellular response to abscisic acid stimulus Biological Process

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT1G65790

ath:AT4G21380

ath:AT4G23140

ath:AT4G23180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.428

Rank 1 · LXL04_034631 · OH-1004

Cell membrane0.370

Rank 2 · LXL04_034631 · OH-1004

Nucleus0.213

Rank 3 · LXL04_034631 · OH-1004

Endoplasmic reticulum0.083

Rank 4 · LXL04_034631 · OH-1004

Golgi apparatus0.080

Rank 5 · LXL04_034631 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714.24PK_Tyr_Ser-Thr1-101 aa

PF11883.14DUF3403106-142 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034631	`PF07714.24`	PK_Tyr_Ser-Thr	1	101	1.2e-08	35.3
LXL04_034631	`PF11883.14`	DUF3403	106	142	9.1e-08	32.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65468`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 8	47.619%	Swiss-Prot	moderate database homology
`Q9C5S9`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 6	51.220%	Swiss-Prot	strong database homology
`O81905`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-8	47.333%	Swiss-Prot	moderate database homology
`Q8GYA4`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 10	45.775%	Swiss-Prot	moderate database homology
`Q39086`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-7	44.667%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card