LXL04_032806 | RubberDandelionOmics

Gene overview

LXL04_032806

Reference: OH-1004 Chr: Chr07 Coordinates: 29622471-29625179 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1902 bp · LXL04_032806|LXL04_032806|OH1004|cDNA

ATGAAAGTTGCAACAGAAAAACCCGTCACGTCCCCCTTTCCTCCTACGTCCACCGCCCTCCGCCCTTCTATCATCTCAATCCATTTCCGCCATAGCAACACATATGAATTTTCAGAAATGAAGCATAAAAGATCCACGTTCAAATCCCTAAATTTGATATCAACGAATACCGCATACATTCCATTTGCTAAGCCTCCAAATCGAAATGAACCAGATTCGGCGAACAAACAAATCAAAGATCCTCCACCTCCGCAACATAC...

CDS

Download CDS FASTA

1902 bp · LXL04_032806|LXL04_032806|OH1004|CDS

ATGAAAGTTGCAACAGAAAAACCCGTCACGTCCCCCTTTCCTCCTACGTCCACCGCCCTCCGCCCTTCTATCATCTCAATCCATTTCCGCCATAGCAACACATATGAATTTTCAGAAATGAAGCATAAAAGATCCACGTTCAAATCCCTAAATTTGATATCAACGAATACCGCATACATTCCATTTGCTAAGCCTCCAAATCGAAATGAACCAGATTCGGCGAACAAACAAATCAAAGATCCTCCACCTCCGCAACATAC...

Protein

Download Protein FASTA

633 aa · LXL04_032806|LXL04_032806|OH1004|PROTEIN

MKVATEKPVTSPFPPTSTALRPSIISIHFRHSNTYEFSEMKHKRSTFKSLNLISTNTAYIPFAKPPNRNEPDSANKQIKDPPPPQHTPPQQETITQHPPPQSEPPLEKPTEQQQDIIKIDKKPSRKVSIANPQPKHTQSVKKPQEVKRMLSAGLQNRVLKTKTGNLKDLYLLGKKLGNGQFGTTYLCKEKSTNKEFACKAIAKRKLVTDEDVEDVRREIEIMHHISGHPNVVSIKGAYEDAVSVYLVMELCGGGELFDRI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032806`
TK1151 ID	TkA08G206150
OH-1004 ID	LXL04_032806
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 97.942 / OH-1004 90.205 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032806

Location Chr07:29622471-29625179 (-)

Description Similar to CPK10: Calcium-dependent protein kinase 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g04870`	May play a role in signal transduction pathways that involve calcium as a second messenger.	A calcium-dependent protein kinase can inhibit a calmodulin-stimulated Ca2+ pump (ACA2) located in the endoplasmic reticulum of Arabidopsis.2000 · DOI: 10.1073/pnas.97.11.6224
`At3g10660`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0788500`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`Os12g0486600`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`Os03g0789000`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032806 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0043067 regulation of programmed cell death Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:1900055 regulation of leaf senescence Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005778 peroxisomal membrane Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT3G10660

ath:AT5G04870

dosa:Os03g0788500

dosa:Os03g0789000

dosa:Os12g0486600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.527

Rank 1 · LXL04_032806 · OH-1004

Cell membrane0.314

Rank 2 · LXL04_032806 · OH-1004

Nucleus0.230

Rank 3 · LXL04_032806 · OH-1004

Golgi apparatus0.097

Rank 4 · LXL04_032806 · OH-1004

Endoplasmic reticulum0.066

Rank 5 · LXL04_032806 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase172-428 aa

PF07714.24PK_Tyr_Ser-Thr172-422 aa

PF13833.13EF-hand_8456-498 aa

PF13499.13EF-hand_7476-535 aa

PF00036.39EF-hand_1476-502 aa

PF13405.13EF-hand_6476-504 aa

PF13202.13EF-hand_5476-498 aa

PF24548.2EF_EFCAB10_C476-514 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032806	`PF00069.32`	Pkinase	172	428	1.5e-79	267.9
LXL04_032806	`PF07714.24`	PK_Tyr_Ser-Thr	172	422	6.4e-27	95.2
LXL04_032806	`PF13833.13`	EF-hand_8	456	498	5.8e-20	71.5
LXL04_032806	`PF13499.13`	EF-hand_7	476	535	4.6e-33	114.1
LXL04_032806	`PF00036.39`	EF-hand_1	476	502	7.8e-31	104.0
LXL04_032806	`PF13405.13`	EF-hand_6	476	504	7e-26	88.1
LXL04_032806	`PF13202.13`	EF-hand_5	476	498	6.9e-23	79.7
LXL04_032806	`PF24548.2`	EF_EFCAB10_C	476	514	3.5e-07	30.5
LXL04_032806	`PF13833.13`	EF-hand_8	491	535	5.8e-20	71.5
LXL04_032806	`PF00036.39`	EF-hand_1	511	535	7.8e-31	104.0
LXL04_032806	`PF13499.13`	EF-hand_7	546	606	4.6e-33	114.1
LXL04_032806	`PF13405.13`	EF-hand_6	548	576	7e-26	88.1
LXL04_032806	`PF00036.39`	EF-hand_1	551	574	7.8e-31	104.0
LXL04_032806	`PF13833.13`	EF-hand_8	577	606	5.8e-20	71.5
LXL04_032806	`PF00036.39`	EF-hand_1	582	606	7.8e-31	104.0
LXL04_032806	`PF13202.13`	EF-hand_5	585	606	6.9e-23	79.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q06850`	Arabidopsis thaliana	Calcium-dependent protein kinase 1	65.693%	Swiss-Prot	strong database homology
`Q38870`	Arabidopsis thaliana	Calcium-dependent protein kinase 2	62.566%	Swiss-Prot	strong database homology
`Q6F3A6`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 10	65.996%	Swiss-Prot	strong database homology
`Q2QQR2`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 27	70.686%	Swiss-Prot	strong database homology
`Q852N6`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 11	66.543%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card