LXL04_032065 | RubberDandelionOmics

Gene overview

LXL04_032065

Reference: OH-1004 Chr: Chr07 Coordinates: 15870452-15876466 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1260 bp · LXL04_032065|LXL04_032065|OH1004|cDNA

ATGGGATTCTCCGCCACTGTCCTCCGCCTACAAATAGCCCATCACACTAAGTACTTCTCCTCCACCACCGTTCTTCAATTCACTACTAAAATGAACGGCAACACCCACCGCTCCCCACTCCACAACAACCCCGGCCACCTCAAAAACCACTCACTTGCTAAGTCTAGTCTCAAAAACGACCGCCGGAGCTGGGTTGATGAGATACGGTGGCGGGTTGGTGAGGCGTCGTGCATGAAATGGACGGCGGATGATGTGTTGGC...

CDS

Download CDS FASTA

1260 bp · LXL04_032065|LXL04_032065|OH1004|CDS

ATGGGATTCTCCGCCACTGTCCTCCGCCTACAAATAGCCCATCACACTAAGTACTTCTCCTCCACCACCGTTCTTCAATTCACTACTAAAATGAACGGCAACACCCACCGCTCCCCACTCCACAACAACCCCGGCCACCTCAAAAACCACTCACTTGCTAAGTCTAGTCTCAAAAACGACCGCCGGAGCTGGGTTGATGAGATACGGTGGCGGGTTGGTGAGGCGTCGTGCATGAAATGGACGGCGGATGATGTGTTGGC...

Protein

Download Protein FASTA

419 aa · LXL04_032065|LXL04_032065|OH1004|PROTEIN

MGFSATVLRLQIAHHTKYFSSTTVLQFTTKMNGNTHRSPLHNNPGHLKNHSLAKSSLKNDRRSWVDEIRWRVGEASCMKWTADDVLAVVKYHPIPCLLAVALLFFMGVEYTLLMIPPSSPPFDIGFMATVNLHRILAGSPALNTILAGLNTVFVGMQTAYIIGTWVVEGRPRATIAALLMFTFRGILGYSTQLPLPQVSTFTFHTVRTESDIKGSYQTPRTPDRVRHQRQKNESAIFIPGPSLRQNIGPSPWSAIKHTDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032065`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032065

Location Chr07:15870452-15876466 (+)

Description Similar to ROD1: Phosphatidylcholine:diacylglycerol cholinephosphotransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15820`	Functions as a phosphatidylcholine:diacylglycerol cholinephosphotransferase that catalyzes the transfer of the phosphocholine headgroup from phosphatidylcholine (PC) to diacylglycerol, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway.	An enzyme regulating triacylglycerol composition is encoded by the ROD1 gene of Arabidopsis.2009 · DOI: 10.1073/pnas.0908848106 Acyl editing and headgroup exchange are the major mechanisms that direct polyunsaturated fatty acid flux into triacylglycerols.2012 · DOI: 10.1104/pp.112.204438
`At3g15830`	Functions as a phosphatidylcholine:diacylglycerol cholinephosphotransferase that catalyzes the transfer of the phosphocholine headgroup from phosphatidylcholine (PC) to diacylglycerol, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032065 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0046470 phosphatidylcholine metabolic process Biological Process

GO:0016020 membrane Cellular Component

GO:0004142 diacylglycerol cholinephosphotransferase activity Molecular Function

KEGG gene cross-reference

ath:AT3G15820

ath:AT3G15830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.479

Rank 1 · LXL04_032065 · OH-1004

Golgi apparatus0.181

Rank 2 · LXL04_032065 · OH-1004

Nucleus0.160

Rank 3 · LXL04_032065 · OH-1004

Cytoplasm0.130

Rank 4 · LXL04_032065 · OH-1004

Cell membrane0.124

Rank 5 · LXL04_032065 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24788.2AtPDCT1_2122-197 aa

PF24788.2AtPDCT1_2306-386 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032065	`PF24788.2`	AtPDCT1_2	122	197	4.5e-78	261.3
LXL04_032065	`PF24788.2`	AtPDCT1_2	306	386	4.5e-78	261.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVZ7`	Arabidopsis thaliana	Phosphatidylcholine:diacylglycerol cholinephosphotransferase 1	70.312%	Swiss-Prot	weak database homology
`Q9LVZ6`	Arabidopsis thaliana	Phosphatidylcholine:diacylglycerol cholinephosphotransferase 2	66.129%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card