LXL04_031128 | RubberDandelionOmics

Gene overview

LXL04_031128

Reference: OH-1004 Chr: Chr07 Coordinates: 961294-964191 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

891 bp · LXL04_031128|LXL04_031128|OH1004|cDNA

ATGCACCTCATAGTGCCCCCAATTTCTTACGTGACCCCCCTCGTGATTAACAAATCTCGAGTCAAAATCCAACACGCCACTCTCAGTTCCGCCATTAATAACCATCGCAATCCTCCTTATATATGCTCCAATCTCACAGGAACCATTCACAATCCCAGAAGCAATCGAGCTATGCTCGACAAGACCATGGGAAGTGAAGGTTCTGATCTGACTGCGAAGCGAAAACCAAGGATCCTCTGCCTCCATGGATTCCGTACAAG...

CDS

Download CDS FASTA

891 bp · LXL04_031128|LXL04_031128|OH1004|CDS

ATGCACCTCATAGTGCCCCCAATTTCTTACGTGACCCCCCTCGTGATTAACAAATCTCGAGTCAAAATCCAACACGCCACTCTCAGTTCCGCCATTAATAACCATCGCAATCCTCCTTATATATGCTCCAATCTCACAGGAACCATTCACAATCCCAGAAGCAATCGAGCTATGCTCGACAAGACCATGGGAAGTGAAGGTTCTGATCTGACTGCGAAGCGAAAACCAAGGATCCTCTGCCTCCATGGATTCCGTACAAG...

Protein

Download Protein FASTA

296 aa · LXL04_031128|LXL04_031128|OH1004|PROTEIN

MHLIVPPISYVTPLVINKSRVKIQHATLSSAINNHRNPPYICSNLTGTIHNPRSNRAMLDKTMGSEGSDLTAKRKPRILCLHGFRTSGEIFKTQLKKWPESVHEKVEFFFPDAPFPSTGKSEVEGIFDPPYYEWFQFNKEFTEYENFDKSIEYIEDLMIKHEIDGLMGFSQGAILSAALPGLQAKGLALTKVPKIGFVIIISGAKLKNQTLAEKAYSVPMQCPSVHFLGEADFLKPYGLELLKTVEDPVVIHHPKGHTIP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031128`
TK1151 ID	TkA08G088490
OH-1004 ID	LXL04_031128
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031128

Location Chr07:961294-964191 (-)

Description Similar to AGAP003155: Esterase AGAP003155

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09280`	Rhodanese-like domain-containing protein 6.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031128 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0032526 response to retinoic acid Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0032153 cell division site Cellular Component

GO:0051286 cell tip Cellular Component

GO:0016787 hydrolase activity Molecular Function

GO:0017171 serine hydrolase activity Molecular Function

GO:0106435 carboxylesterase activity Molecular Function

KEGG gene cross-reference

aag:5563630

aga:1273826

ath:AT1G09280

mmu:246257

spo:2541420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.740

Rank 1 · LXL04_031128 · OH-1004

Cytoplasm0.286

Rank 2 · LXL04_031128 · OH-1004

Nucleus0.153

Rank 3 · LXL04_031128 · OH-1004

Peroxisome0.063

Rank 4 · LXL04_031128 · OH-1004

Mitochondrion0.052

Rank 5 · LXL04_031128 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02230.23Abhydrolase_273-241 aa

PF03959.20FSH174-263 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031128	`PF02230.23`	Abhydrolase_2	73	241	4e-08	34.1
LXL04_031128	`PF03959.20`	FSH1	74	263	3.9e-49	167.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AC1`	Arabidopsis thaliana	Rhodanese-like domain-containing protein 6	29.075%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card