LXL04_029887 | RubberDandelionOmics

Gene overview

LXL04_029887

Reference: OH-1004 Chr: Chr06 Coordinates: 102844540-102849523 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3687 bp · LXL04_029887|LXL04_029887|OH1004|cDNA

ATGGCGTCcacctcttcttcttcttcatcttcttcttcgtcttctcATCGCCATGAATCCATAGACCCTAAGCTTTTAAGATTACTCGTTTCTTTGATCAATGACCACATTTACTCGTTCTTATCCAACCACAAGTCCAGAAAGATACTACACGCTATATGCTCCTCAAATCTCAAGTTTCACGAGCAGGATTTCTTCGACTTCTCGGAACAATCAGTACTCTCGAATTTTTACTGGGGTATTCAGAATGTAGAAGCTGC...

CDS

Download CDS FASTA

3687 bp · LXL04_029887|LXL04_029887|OH1004|CDS

ATGGCGTCCACCTCTTCTTCTTCTTCATCTTCTTCTTCGTCTTCTCATCGCCATGAATCCATAGACCCTAAGCTTTTAAGATTACTCGTTTCTTTGATCAATGACCACATTTACTCGTTCTTATCCAACCACAAGTCCAGAAAGATACTACACGCTATATGCTCCTCAAATCTCAAGTTTCACGAGCAGGATTTCTTCGACTTCTCGGAACAATCAGTACTCTCGAATTTTTACTGGGGTATTCAGAATGTAGAAGCTGC...

Protein

Download Protein FASTA

1228 aa · LXL04_029887|LXL04_029887|OH1004|PROTEIN

MASTSSSSSSSSSSSHRHESIDPKLLRLLVSLINDHIYSFLSNHKSRKILHAICSSNLKFHEQDFFDFSEQSVLSNFYWGIQNVEAAVQSKCPEDIKPKLQRAEKMLQAPALLNEDGTTAGVSNSYLVCYAYFYLSVVRKLQRDELQVSVHFLQALVVSPAVVRVELAPELYRAIVESCIVPLRPEFRNEVEESEGVKWGARSYKAWLMYHQVISYGQSPLLMKEPDENLLEIRNMNACSTSSSNSYEHMHHLHQLRMHQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029887`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_029887`
Location	Chr06:102844540-102849523 (-)
Description	Similar to CERBERUS: Putative E3 ubiquitin-protein ligase LIN-1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029887` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0009877 nodulation Biological Process GO:0016567 protein ubiquitination Biological Process GO:0061630 ubiquitin protein ligase activity Molecular Function
KEGG gene cross-reference	mtr:11418360 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.453

Rank 1 · LXL04_029887 · OH-1004

Nucleus0.366

Rank 2 · LXL04_029887 · OH-1004

Cell membrane0.257

Rank 3 · LXL04_029887 · OH-1004

Endoplasmic reticulum0.064

Rank 4 · LXL04_029887 · OH-1004

Lysosome / Vacuole0.060

Rank 5 · LXL04_029887 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23568.2ARM_LIN28-192 aa

PF23654.2ARM_LIN_2nd403-565 aa

PF23628.3ARM_LIN_C568-922 aa

PF24807.2WD40_CDC20-Fz907-1036 aa

PF23409.2Beta-prop_EML957-1053 aa

PF25173.2Beta-prop_WDR3_1st960-1101 aa

PF23381.2Beta-prop_IFT122_1st960-1225 aa

PF25174.2Beta-prop_THOC3960-1204 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029887	`PF23568.2`	ARM_LIN	28	192	4.4e-27	95.6
LXL04_029887	`PF23654.2`	ARM_LIN_2nd	403	565	3.8e-50	170.4
LXL04_029887	`PF23628.3`	ARM_LIN_C	568	922	2.7e-59	201.7
LXL04_029887	`PF24807.2`	WD40_CDC20-Fz	907	1036	8.7e-10	39.1
LXL04_029887	`PF23409.2`	Beta-prop_EML	957	1053	1.1e-07	32.4
LXL04_029887	`PF25173.2`	Beta-prop_WDR3_1st	960	1101	1.1e-13	52.0
LXL04_029887	`PF23381.2`	Beta-prop_IFT122_1st	960	1225	2.9e-13	50.5
LXL04_029887	`PF25174.2`	Beta-prop_THOC3	960	1204	1.9e-09	37.6
LXL04_029887	`PF25172.2`	Beta-prop_WDR3_2nd	960	1020	1.7e-07	31.5
LXL04_029887	`PF25175.2`	Beta-prop_WDR5	961	1091	1.9e-10	41.3
LXL04_029887	`PF24796.2`	WDR55	962	1071	1.3e-06	28.4
LXL04_029887	`PF24814.2`	WD40_Prp19	963	1037	5.7e-10	39.4
LXL04_029887	`PF00400.39`	WD40	982	1017	8.7e-07	29.9
LXL04_029887	`PF24817.2`	WD40_WDHD1_1st	989	1152	6.6e-07	29.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card