LXL04_029678 | RubberDandelionOmics

Gene overview

LXL04_029678

Reference: OH-1004 Chr: Chr06 Coordinates: 96919026-96922711 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2253 bp · LXL04_029678|LXL04_029678|OH1004|cDNA

ATGGGAGGAGGATTCTCGCAGCTCCTCCCCTGCTTCAATCCGGCGGAGAGACGGCGGACTGAATCACCGGAGCTGATTTTCACGGAAACCGACCCTTTAGACGAAACCCTAGGTCACTCCTTTTGTTATGTTCGTTCATCAGCTCGGTTCCTCTCTCCGACTCAGTCCGATCATTTTATTTCTCCTTCGCAATCTCTACGATTCTCTCCGTCGCACGAATCTTCCTCGTCGAGGTCGCGGCAACCGTACGGCGTGTCCGA...

CDS

Download CDS FASTA

2253 bp · LXL04_029678|LXL04_029678|OH1004|CDS

ATGGGAGGAGGATTCTCGCAGCTCCTCCCCTGCTTCAATCCGGCGGAGAGACGGCGGACTGAATCACCGGAGCTGATTTTCACGGAAACCGACCCTTTAGACGAAACCCTAGGTCACTCCTTTTGTTATGTTCGTTCATCAGCTCGGTTCCTCTCTCCGACTCAGTCCGATCATTTTATTTCTCCTTCGCAATCTCTACGATTCTCTCCGTCGCACGAATCTTCCTCGTCGAGGTCGCGGCAACCGTACGGCGTGTCCGA...

Protein

Download Protein FASTA

750 aa · LXL04_029678|LXL04_029678|OH1004|PROTEIN

MGGGFSQLLPCFNPAERRRTESPELIFTETDPLDETLGHSFCYVRSSARFLSPTQSDHFISPSQSLRFSPSHESSSSRSRQPYGVSETGFKAISGASVSANTSTPRTVLQLENIYDDATDSVGGGVKSSIVNGFESTSSFSALPLQPLPRGDSARAASGQMERAFFMSGPIERGALSGPLDSNLGSDSNSGIPFSAPLNGGMYVKKKRKKAIPGIRKAFNRNFPRPWIVPVRSFVGGRKEAPTGGAVEESEMKNESDVQW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029678`
TK1151 ID	TkA07G335540
OH-1004 ID	LXL04_029678
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029678

Location Chr06:96919026-96922711 (-)

Description Similar to PLL1: Protein phosphatase 2C 29

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g35350`	Involved in the regulation of pedicel length and of CLAVATA pathways controlling stem cell identity at shoot and flower meristems.	POL and related phosphatases are dosage-sensitive regulators of meristem and organ development in Arabidopsis.2005 · DOI: 10.1016/j.ydbio.2005.06.020 POL and PLL1 phosphatases are CLAVATA1 signaling intermediates required for Arabidopsis shoot and floral stem cells.2006 · DOI: 10.1242/dev.02652
`At2g46920`	Involved in the regulation of pedicel length and of CLAVATA pathways controlling stem cell identity at shoot and flower meristems.	No verified direct reference in this release
`At1g07630`	Involved in leaf development regulation.	POL and related phosphatases are dosage-sensitive regulators of meristem and organ development in Arabidopsis.2005 · DOI: 10.1016/j.ydbio.2005.06.020

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0690500`	Probable protein phosphatase 2C 26.	No verified direct reference in this release
`Os03g0821300`	Protein phosphatase that acts on XA21 pathogen recognition receptor.	Rice XB15, a protein phosphatase 2C, negatively regulates cell death and XA21-mediated innate immunity.2008 · DOI: 10.1371/journal.pbio.0060231

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029678 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0010074 maintenance of meristem identity Biological Process

GO:0048827 phyllome development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0005543 phospholipid binding Molecular Function

KEGG gene cross-reference

ath:AT2G35350

ath:AT2G46920

dosa:Os02g0690500

dosa:Os03g0821300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.277

Rank 1 · LXL04_029678 · OH-1004

Cell membrane0.273

Rank 2 · LXL04_029678 · OH-1004

Cytoplasm0.269

Rank 3 · LXL04_029678 · OH-1004

Plastid0.110

Rank 4 · LXL04_029678 · OH-1004

Endoplasmic reticulum0.107

Rank 5 · LXL04_029678 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C487-705 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029678	`PF00481.27`	PP2C	487	705	5e-27	95.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82302`	Arabidopsis thaliana	Protein phosphatase 2C 29	55.501%	Swiss-Prot	strong database homology
`Q8RWN7`	Arabidopsis thaliana	Protein phosphatase 2C 32	41.488%	Swiss-Prot	moderate database homology
`Q9LQN6`	Arabidopsis thaliana	Probable protein phosphatase 2C 4	57.525%	Swiss-Prot	weak database homology
`Q6ZGY0`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 26	43.022%	Swiss-Prot	moderate database homology
`Q84T94`	Oryza sativa subsp. japonica	Protein phosphatase 2C 35	58.940%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card