LXL04_029214 | RubberDandelionOmics

Gene overview

LXL04_029214

Reference: OH-1004 Chr: Chr06 Coordinates: 83878854-83882981 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1620 bp · LXL04_029214|LXL04_029214|OH1004|cDNA

ATGACTTCCGTCTCAGCGTCTGATCAATCGAGTTGCAGAGTTGCGATTGCCGATTTGCCGAGTTTTTGCGTCTCAACGTCTGATCAATCGACGATTTGCCGGTTTTTGCGTCTCAGCGTCTCAGCGTCGAATGTGGGCCCTGTGCCTTTGCCCTTCTTGTCCCTCCTTTGCAACGCCCCTGACcGAACCGAGACTTCCAAAAAGGGTGATTTAACAACTACCACTTCTGCTCAACCAAAGAACCTAGGCGATGGTACTAC...

CDS

Download CDS FASTA

1620 bp · LXL04_029214|LXL04_029214|OH1004|CDS

ATGACTTCCGTCTCAGCGTCTGATCAATCGAGTTGCAGAGTTGCGATTGCCGATTTGCCGAGTTTTTGCGTCTCAACGTCTGATCAATCGACGATTTGCCGGTTTTTGCGTCTCAGCGTCTCAGCGTCGAATGTGGGCCCTGTGCCTTTGCCCTTCTTGTCCCTCCTTTGCAACGCCCCTGACCGAACCGAGACTTCCAAAAAGGGTGATTTAACAACTACCACTTCTGCTCAACCAAAGAACCTAGGCGATGGTACTAC...

Protein

Download Protein FASTA

539 aa · LXL04_029214|LXL04_029214|OH1004|PROTEIN

MTSVSASDQSSCRVAIADLPSFCVSTSDQSTICRFLRLSVSASNVGPVPLPFLSLLCNAPDRTETSKKGDLTTTTSAQPKNLGDGTTSGKSISIIPSHGTSESPYGKNPQQVATEIYRVISGHLGWVRSIAFDPRLAMSTRHTCMFSVGDDKLDKCWDLEQNKVIRSYHGHLSGVYCLALHPIIDVLLTDGRDSVCGAVKLEDGGKTTREIDQENMSTGQRDALLLFRTLCKGLLEGVSHSFTNNFNIIDSVKAYLSYVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029214`
TK1151 ID	TkA07G285260
OH-1004 ID	LXL04_029214
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029214

Location Chr06:83878854-83882981 (-)

Description Similar to TLP1: Thaumatin-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g24180`	Involved in local responses of roots to colonization by non-pathogenic plant growth-promoting rhizobacteria (PGPR) fluorescent Pseudomonas spp., but does not seem to be required for the establishment of subsequent induced systemic resistance (ISR).	No verified direct reference in this release
`At4g15900`	Pleiotropic regulator of glucose, stress and hormone responses.	Regulatory interaction of PRL1 WD protein with Arabidopsis SNF1-like protein kinases.1999 · DOI: 10.1073/pnas.96.9.5322 SKP1-SnRK protein kinase interactions mediate proteasomal binding of a plant SCF ubiquitin ligase.2001 · DOI: 10.1093/emboj/20.11.2742 Regulation of plant innate immunity by three proteins in a complex conserved across the plant and animal kingdoms.2007 · DOI: 10.1101/gad.1559607 Signaling from an altered cell wall to the nucleus mediates sugar-responsive growth and development in Arabidopsis thaliana.2007 · DOI: 10.1105/tpc.106.049965 Characterization of Arabidopsis and rice DWD proteins and their roles as substrate receptors for CUL4-RING E3 ubiquitin ligases.2008 · DOI: 10.1105/tpc.107.055418 Modulation of O-mediated retrograde signaling by the PLEIOTROPIC RESPONSE LOCUS 1 (PRL1) protein, a central integrator of stress and energy signaling.2009 · DOI: 10.1111/j.1365-313x.2009.03935.x Pleiotropic regulatory locus 1 (PRL1) integrates the regulation of sugar responses with isoprenoid metabolism in Arabidopsis.2010 · DOI: 10.1093/mp/ssp100 Pleiotropic control of glucose and hormone responses by PRL1, a nuclear WD protein, in Arabidopsis.1998 · DOI: 10.1101/gad.12.19.3059
`At5g38280`	Possesses kinase activity in vitro.	The PR5K receptor protein kinase from Arabidopsis thaliana is structurally related to a family of plant defense proteins.1996 · DOI: 10.1073/pnas.93.6.2598

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029214 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006396 RNA processing Biological Process

GO:0006952 defense response Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009620 response to fungus Biological Process

GO:0009682 induced systemic resistance Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009749 response to glucose Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0010154 fruit development Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:0010215 cellulose microfibril organization Biological Process

KEGG gene cross-reference

ath:AT4G15900

ath:AT4G24180

ath:AT5G38280

mdm:103411735

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.330

Rank 1 · LXL04_029214 · OH-1004

Cytoplasm0.280

Rank 2 · LXL04_029214 · OH-1004

Cell membrane0.250

Rank 3 · LXL04_029214 · OH-1004

Endoplasmic reticulum0.173

Rank 4 · LXL04_029214 · OH-1004

Lysosome / Vacuole0.068

Rank 5 · LXL04_029214 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24814.2WD40_Prp19113-214 aa

PF00314.23Thaumatin412-526 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029214	`PF24814.2`	WD40_Prp19	113	214	1.9e-06	27.9
LXL04_029214	`PF00314.23`	Thaumatin	412	526	3.8e-39	135.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A0A1P8B554`	Arabidopsis thaliana	Thaumatin-like protein 1	53.416%	Swiss-Prot	weak database homology
`Q42384`	Arabidopsis thaliana	Protein pleiotropic regulatory locus 1	42.718%	Swiss-Prot	weak database homology
`Q9FF29`	Arabidopsis thaliana	PR5-like receptor kinase	48.175%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card