LXL04_026052 | RubberDandelionOmics

Gene overview

LXL04_026052

Reference: OH-1004 Chr: Chr05 Coordinates: 120157301-120162968 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3213 bp · LXL04_026052|LXL04_026052|OH1004|cDNA

ATGGATTCGTATATTCATAACTTCCCAACTTTATTTTTCACTCCTACTTCTTTGATTCCGAACAAAATTCTCAAGAATCCCAACCCGATTTCATGCAACTGCCGTAATTTTCTCAGAGATCACAATAAGAGTAGGAAAATCAGAGTCATAGCAGGTTCTAAGATGGGAGAGAGTGCAGCGGCATCCGCGATTAAAATGGTTTTTGAACCGATTCTTGAAGAAGGTGTTTTCAGGTTCGATTGTTCAGCTGATGCTAGAAC...

CDS

Download CDS FASTA

3213 bp · LXL04_026052|LXL04_026052|OH1004|CDS

ATGGATTCGTATATTCATAACTTCCCAACTTTATTTTTCACTCCTACTTCTTTGATTCCGAACAAAATTCTCAAGAATCCCAACCCGATTTCATGCAACTGCCGTAATTTTCTCAGAGATCACAATAAGAGTAGGAAAATCAGAGTCATAGCAGGTTCTAAGATGGGAGAGAGTGCAGCGGCATCCGCGATTAAAATGGTTTTTGAACCGATTCTTGAAGAAGGTGTTTTCAGGTTCGATTGTTCAGCTGATGCTAGAAC...

Protein

Download Protein FASTA

1070 aa · LXL04_026052|LXL04_026052|OH1004|PROTEIN

MDSYIHNFPTLFFTPTSLIPNKILKNPNPISCNCRNFLRDHNKSRKIRVIAGSKMGESAAASAIKMVFEPILEEGVFRFDCSADARTEAFPSVSFVNSKHRETPITSNHKVPSYIPTSEHVSGQQIVYFEVMNMVISFLQELRFTEQGKLVDRLKEQEKESVSNDISSTSFHKLSVICHNECDKLQVFTWNTDAWGYGTGTTSLYQSHPWILAILSNGEAFGFLADTTKRCEIDLRKESTAKLIAPSPFPVVTFGPFDSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026052`
TK1151 ID	TkA06G029810
OH-1004 ID	LXL04_026052
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026052

Location Chr05:120157301-120162968 (-)

Description Similar to Alpha-glucosidase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0216600`	Cleaves sequentially the 2 innermost alpha-1,3-linked glucose residues from the Glc(2)Man(9)GlcNAc(2) oligosaccharide precursor of immature glycoproteins.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026052 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006491 N-glycan processing Biological Process

GO:0006952 defense response Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005788 endoplasmic reticulum lumen Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0016020 membrane Cellular Component

GO:0017177 glucosidase II complex Cellular Component

GO:0043231 intracellular membrane-bounded organelle Cellular Component

GO:0070062 extracellular exosome Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

dosa:Os03g0216600

hsa:23193

mmu:14376

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.885

Rank 1 · LXL04_026052 · OH-1004

Cytoplasm0.089

Rank 2 · LXL04_026052 · OH-1004

Mitochondrion0.056

Rank 3 · LXL04_026052 · OH-1004

Peroxisome0.050

Rank 4 · LXL04_026052 · OH-1004

Cell membrane0.034

Rank 5 · LXL04_026052 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13802.13Gal_mutarotas_2187-234 aa

PF01055.33Glyco_hydro_31_2nd275-604 aa

PF17137.10DUF5110708-773 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026052	`PF13802.13`	Gal_mutarotas_2	187	234	6.7e-08	33.7
LXL04_026052	`PF01055.33`	Glyco_hydro_31_2nd	275	604	1.4e-126	422.9
LXL04_026052	`PF17137.10`	DUF5110	708	773	2.3e-10	41.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B9F676`	Oryza sativa subsp. japonica	Probable glucan 1,3-alpha-glucosidase	36.770%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card