LXL04_024559 | RubberDandelionOmics

Gene overview

LXL04_024559

Reference: OH-1004 Chr: Chr05 Coordinates: 93751822-93755868 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1755 bp · LXL04_024559|LXL04_024559|OH1004|cDNA

ATGTCTGACTTTGAGTTCTTCCTCTATGTATCTCTTCTAATTTCGACTCTCTTTCTCCTCTTAAATCTTGCCAAAAAAAGAACCCACCACACTCCGCCTCTCAACCTTCCACCGGGGAACATGGGCTGGCCGTTCATCGGAGAAACCATGGGGTACCTCAAGCCCTACTCCGCCACCACCATCGGAGCATTCATGGACCAACATATATCAAGGTTCGGAAAGATATACAAATCAAACTTATTTGGGGAGCCGACGATAGT...

CDS

Download CDS FASTA

1755 bp · LXL04_024559|LXL04_024559|OH1004|CDS

ATGTCTGACTTTGAGTTCTTCCTCTATGTATCTCTTCTAATTTCGACTCTCTTTCTCCTCTTAAATCTTGCCAAAAAAAGAACCCACCACACTCCGCCTCTCAACCTTCCACCGGGGAACATGGGCTGGCCGTTCATCGGAGAAACCATGGGGTACCTCAAGCCCTACTCCGCCACCACCATCGGAGCATTCATGGACCAACATATATCAAGGTTCGGAAAGATATACAAATCAAACTTATTTGGGGAGCCGACGATAGT...

Protein

Download Protein FASTA

584 aa · LXL04_024559|LXL04_024559|OH1004|PROTEIN

MSDFEFFLYVSLLISTLFLLLNLAKKRTHHTPPLNLPPGNMGWPFIGETMGYLKPYSATTIGAFMDQHISRFGKIYKSNLFGEPTIVSADPGLNRYILQNEGRLFECSYPRSIGGILGKWSMLVLVGDMHRDMRLISLNFLTNARLKTQLVREVEKNTLWVLDSWKENCSFCAQDEAKKFTFNLMAKHIMSLEPGKPETEQLKKEYVTFMKGVVSAPLNFPGTAYRKALKFHARFDDHSNKSRSTILKFIEMRMEERIQK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024559`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024559

Location Chr05:93751822-93755868 (+)

Description Similar to CYP90B1: Cytochrome P450 90B1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50660`	Catalyzes the C22-alpha-hydroxylation step in brassinosteroids biosynthesis.	Arabidopsis CYP90B1 catalyses the early C-22 hydroxylation of C27, C28 and C29 sterols.2006 · DOI: 10.1111/j.1365-313x.2005.02639.x The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22alpha-hydroxylation steps in brassinosteroid biosynthesis.1998 · DOI: 10.1105/tpc.10.2.231

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0227700`	Catalyzes the C22-alpha-hydroxylation step in brassinosteroid biosynthesis, which is the rate-limiting step in this biosynthetic pathway.	Erect leaves caused by brassinosteroid deficiency increase biomass production and grain yield in rice.2006 · DOI: 10.1038/nbt1173 Involvement of C-22-hydroxylated brassinosteroids in auxin-induced lamina joint bending in rice.2009 · DOI: 10.1093/pcp/pcp106

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024559 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006694 steroid biosynthetic process Biological Process

GO:0008203 cholesterol metabolic process Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010268 brassinosteroid homeostasis Biological Process

GO:0010358 leaf shaping Biological Process

GO:0016132 brassinosteroid biosynthetic process Biological Process

GO:0048366 leaf development Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT3G50660

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.871

Rank 1 · LXL04_024559 · OH-1004

Golgi apparatus0.065

Rank 2 · LXL04_024559 · OH-1004

Nucleus0.040

Rank 3 · LXL04_024559 · OH-1004

Cytoplasm0.038

Rank 4 · LXL04_024559 · OH-1004

Plastid0.038

Rank 5 · LXL04_024559 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067.28p45037-419 aa

PF00067.28p450513-560 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024559	`PF00067.28`	p450	37	419	1.1e-58	199.8
LXL04_024559	`PF00067.28`	p450	513	560	1.1e-58	199.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64989`	Arabidopsis thaliana	Steroid (22S)-hydroxylase	71.256%	Swiss-Prot	moderate database homology
`Q5CCK3`	Oryza sativa subsp. japonica	Steroid (22S)-hydroxylase	66.089%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card