LXL04_023991 | RubberDandelionOmics

Gene overview

LXL04_023991

Reference: OH-1004 Chr: Chr05 Coordinates: 77017279-77021138 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1707 bp · LXL04_023991|LXL04_023991|OH1004|cDNA

ATGGCAGCGATTTTCTCTTGCCACTCTTGTTCTTCTCTCTACACCAGTTCTAAATCATCCCTCTTCAACAACCATAAGCAATCGATCAACTACATTCGTGTGTCACATTCCTCCAACAATGCTTCAATTCCACGATTCAGACCAATTTGTTCTTCGCAAAACCCTAATCGACTTCAATTCAGCGACATACAGACAGATAAGTTCTCTGGGATAAAAGAATGTGTGTTATCTGTAGCTTTAGCAATCGGATTGATAACTGG...

CDS

Download CDS FASTA

1707 bp · LXL04_023991|LXL04_023991|OH1004|CDS

ATGGCAGCGATTTTCTCTTGCCACTCTTGTTCTTCTCTCTACACCAGTTCTAAATCATCCCTCTTCAACAACCATAAGCAATCGATCAACTACATTCGTGTGTCACATTCCTCCAACAATGCTTCAATTCCACGATTCAGACCAATTTGTTCTTCGCAAAACCCTAATCGACTTCAATTCAGCGACATACAGACAGATAAGTTCTCTGGGATAAAAGAATGTGTGTTATCTGTAGCTTTAGCAATCGGATTGATAACTGG...

Protein

Download Protein FASTA

568 aa · LXL04_023991|LXL04_023991|OH1004|PROTEIN

MAAIFSCHSCSSLYTSSKSSLFNNHKQSINYIRVSHSSNNASIPRFRPICSSQNPNRLQFSDIQTDKFSGIKECVLSVALAIGLITGVPSFGFPSDANAIAPVIPDLAVLISGPPIKDPGALLRYALPIDNKAIREVQKPLEDITDSLKVSGVKALDSVERNLKQASRALKQGKSMIIAGLAESKKDHAIELLGKLEVGMEELQKIAEDRKRDAVVPKQKELLQYVGGVEEDMVNGFPYEIPEEYQNMPLLKGRATVDMK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023991`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023991

Location Chr05:77017279-77021138 (-)

Description Similar to CYP38: Peptidyl-prolyl cis-trans isomerase CYP38, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01480`	Required for the assembly and stabilization of PSII, but has no PPIases activity.	A chloroplast cyclophilin functions in the assembly and maintenance of photosystem II in Arabidopsis thaliana.2007 · DOI: 10.1073/pnas.0707851104 Crystal structure of Arabidopsis cyclophilin38 reveals a previously uncharacterized immunophilin fold and a possible autoinhibitory mechanism.2012 · DOI: 10.1105/tpc.111.093781
`At3g15520`	PPIases accelerate the folding of proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023991 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0010207 photosystem II assembly Biological Process

GO:0042549 photosystem II stabilization Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009543 chloroplast thylakoid lumen Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0031977 thylakoid lumen Cellular Component

KEGG gene cross-reference

ath:AT3G01480

ath:AT3G15520

syn:sll0227

syn:sll0408

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.986

Rank 1 · LXL04_023991 · OH-1004

Mitochondrion0.021

Rank 2 · LXL04_023991 · OH-1004

Cytoplasm0.016

Rank 3 · LXL04_023991 · OH-1004

Peroxisome0.013

Rank 4 · LXL04_023991 · OH-1004

Cell membrane0.013

Rank 5 · LXL04_023991 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21329.3CYP38_PsbQ-like118-234 aa

PF00160.27Pro_isomerase274-433 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023991	`PF21329.3`	CYP38_PsbQ-like	118	234	8.6e-44	149.5
LXL04_023991	`PF00160.27`	Pro_isomerase	274	433	2.2e-23	83.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SSA5`	Arabidopsis thaliana	Peptidyl-prolyl cis-trans isomerase CYP38, chloroplastic	74.941%	Swiss-Prot	strong database homology
`P82869`	Arabidopsis thaliana	Peptidyl-prolyl cis-trans isomerase CYP37, chloroplastic	30.127%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card