LXL04_023226 | RubberDandelionOmics

Gene overview

LXL04_023226

Reference: OH-1004 Chr: Chr05 Coordinates: 27536356-27542147 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

984 bp · LXL04_023226|LXL04_023226|OH1004|cDNA

ATGGCTATGATCAAGTCCCCGGCCGTTCTTCTGCTGGCGatggtggttgtggttgttggAGAGCTTCAAAGATTTGATCATGCCGTGAAATCTGACGGATCTGTCAGATTTTTGGTCGTCGGTGATTGGGGTAGGAGAGGACTGTACAACCAATCTCATGTCGCTTACCAGATGGGCAAAGTGGGAGAGAAAATGGACGTGGACTTTATCATTTCCACTGGTGATAATTTTTACGACAGTGGATTAGTTGACGTGGATGA...

CDS

Download CDS FASTA

984 bp · LXL04_023226|LXL04_023226|OH1004|CDS

ATGGCTATGATCAAGTCCCCGGCCGTTCTTCTGCTGGCGATGGTGGTTGTGGTTGTTGGAGAGCTTCAAAGATTTGATCATGCCGTGAAATCTGACGGATCTGTCAGATTTTTGGTCGTCGGTGATTGGGGTAGGAGAGGACTGTACAACCAATCTCATGTCGCTTACCAGATGGGCAAAGTGGGAGAGAAAATGGACGTGGACTTTATCATTTCCACTGGTGATAATTTTTACGACAGTGGATTAGTTGACGTGGATGA...

Protein

Download Protein FASTA

327 aa · LXL04_023226|LXL04_023226|OH1004|PROTEIN

MAMIKSPAVLLLAMVVVVVGELQRFDHAVKSDGSVRFLVVGDWGRRGLYNQSHVAYQMGKVGEKMDVDFIISTGDNFYDSGLVDVDDPAFYESFTNVYTAPSLQKQWYSVLGNHDYRGNALAQLSPVLTQRDNKWLCLRSYMLHAGNTEFFFVDTTPFQDKYFTETEHNYDWRGVLPRANYIANLLKDVDIALKASSAKWKIVIGHHTIFSAGDHGNTQELVNQLLPILKANDVNLYINGHDHCLQRISSPDSKLQFLTS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023226`
TK1151 ID	TkA06G387660
OH-1004 ID	LXL04_023226
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023226

Location Chr05:27536356-27542147 (-)

Description Similar to PAP17: Purple acid phosphatase 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17790`	Metallo-phosphoesterase involved in phosphate metabolism.	A type 5 acid phosphatase gene from Arabidopsis thaliana is induced by phosphate starvation and by some other types of phosphate mobilising/oxidative stress conditions.1999 · DOI: 10.1046/j.1365-313x.1999.00562.x
`At1g14700`	Purple acid phosphatase 3.	No verified direct reference in this release
`At2g01890`	Purple acid phosphatase 8.	No verified direct reference in this release
`At2g01880`	Purple acid phosphatase 7.	No verified direct reference in this release
`At1g25230`	Purple acid phosphatase 4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023226 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016311 dephosphorylation Biological Process

GO:0030643 intracellular phosphate ion homeostasis Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009986 cell surface Cellular Component

GO:0003993 acid phosphatase activity Molecular Function

GO:0008198 ferrous iron binding Molecular Function

GO:0008199 ferric iron binding Molecular Function

GO:0016791 phosphatase activity Molecular Function

GO:0140825 lactoperoxidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G14700

ath:AT1G25230

ath:AT2G01880

ath:AT2G01890

ath:AT3G17790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.517

Rank 1 · LXL04_023226 · OH-1004

Extracellular0.165

Rank 2 · LXL04_023226 · OH-1004

Cytoplasm0.143

Rank 3 · LXL04_023226 · OH-1004

Cell membrane0.132

Rank 4 · LXL04_023226 · OH-1004

Endoplasmic reticulum0.114

Rank 5 · LXL04_023226 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00149.34Metallophos36-244 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023226	`PF00149.34`	Metallophos	36	244	1.2e-18	69.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCX8`	Arabidopsis thaliana	Purple acid phosphatase 17	60.366%	Swiss-Prot	strong database homology
`Q8H129`	Arabidopsis thaliana	Purple acid phosphatase 3	62.876%	Swiss-Prot	strong database homology
`Q8VYZ2`	Arabidopsis thaliana	Purple acid phosphatase 8	59.692%	Swiss-Prot	strong database homology
`Q8S341`	Arabidopsis thaliana	Purple acid phosphatase 7	60.615%	Swiss-Prot	strong database homology
`Q8VYU7`	Arabidopsis thaliana	Purple acid phosphatase 4	59.396%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card