LXL04_023165 | RubberDandelionOmics

Gene overview

LXL04_023165

Reference: OH-1004 Chr: Chr05 Coordinates: 25470118-25479097 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3636 bp · LXL04_023165|LXL04_023165|OH1004|cDNA

ATGGGCCATAGTTCAAAAAAGAAGAAGCGCGGTGGCACTGGGAGGCGAAGGGCGCCCACCAATGATCACACTTCTATCGACGGCGTTGGCGGCGAACTTCTGTCAGAGGAGCTTACCGCAGTGCGTGCAATATTTCACGAAGATTGCGACTTTGTCTCAGAGTCTCCACCCCGAATCAAGATCAAGCTAAGGCCATATTCACAGGATTCAGGTTATGAGGATTTAGACGTATCTGCCCTTCTTTCGATAAGATTTTTACC...

CDS

Download CDS FASTA

3636 bp · LXL04_023165|LXL04_023165|OH1004|CDS

ATGGGCCATAGTTCAAAAAAGAAGAAGCGCGGTGGCACTGGGAGGCGAAGGGCGCCCACCAATGATCACACTTCTATCGACGGCGTTGGCGGCGAACTTCTGTCAGAGGAGCTTACCGCAGTGCGTGCAATATTTCACGAAGATTGCGACTTTGTCTCAGAGTCTCCACCCCGAATCAAGATCAAGCTAAGGCCATATTCACAGGATTCAGGTTATGAGGATTTAGACGTATCTGCCCTTCTTTCGATAAGATTTTTACC...

Protein

Download Protein FASTA

1211 aa · LXL04_023165|LXL04_023165|OH1004|PROTEIN

MGHSSKKKKRGGTGRRRAPTNDHTSIDGVGGELLSEELTAVRAIFHEDCDFVSESPPRIKIKLRPYSQDSGYEDLDVSALLSIRFLPGYPYKCPKLLIIPEKGLSKSDADNLLSLLHDQANLNAREGRVMIYNLVEAAQEFLSEVVPLEQPHVPCATTDRPSKGPFVYGFIDLFMGSGESWPWGLSIEESNNKDNTLQLDDPHNEKKVNQIMKTGVVEDGDVDKVISHTERLDGLEEESKSNDSFTSSSEESVENVSIGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023165`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023165

Location Chr05:25470118-25479097 (-)

Description Similar to GCN2: eIF-2-alpha kinase GCN2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59410`	Metabolic-stress sensing protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 eIF-2-alpha in response to low amino acid availability.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023165 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000077 DNA damage checkpoint signaling Biological Process

GO:0006412 translation Biological Process

GO:0006446 regulation of translational initiation Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006521 regulation of amino acid metabolic process Biological Process

GO:0009635 response to herbicide Biological Process

GO:0009893 positive regulation of metabolic process Biological Process

GO:0010508 positive regulation of autophagy Biological Process

GO:0018105 peptidyl-serine phosphorylation Biological Process

GO:0031571 mitotic G1 DNA damage checkpoint signaling Biological Process

GO:0031589 cell-substrate adhesion Biological Process

GO:0032057 negative regulation of translational initiation in response to stress Biological Process

KEGG gene cross-reference

ath:AT3G59410

ddi:DDB_G0276829

sce:YDR283C

spo:2540500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.533

Rank 1 · LXL04_023165 · OH-1004

Nucleus0.399

Rank 2 · LXL04_023165 · OH-1004

Cell membrane0.096

Rank 3 · LXL04_023165 · OH-1004

Golgi apparatus0.078

Rank 4 · LXL04_023165 · OH-1004

Endoplasmic reticulum0.057

Rank 5 · LXL04_023165 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05773.28RWD32-142 aa

PF00069.32Pkinase395-701 aa

PF07714.24PK_Tyr_Ser-Thr398-461 aa

PF07714.24PK_Tyr_Ser-Thr508-698 aa

PF13393.12tRNA-synt_His859-1087 aa

PF12745.13HGTP_anticodon21106-1203 aa

PF03129.26HGTP_anticodon1110-1198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023165	`PF05773.28`	RWD	32	142	4.8e-18	66.1
LXL04_023165	`PF00069.32`	Pkinase	395	701	4.8e-50	171.1
LXL04_023165	`PF07714.24`	PK_Tyr_Ser-Thr	398	461	3.6e-25	89.5
LXL04_023165	`PF07714.24`	PK_Tyr_Ser-Thr	508	698	3.6e-25	89.5
LXL04_023165	`PF13393.12`	tRNA-synt_His	859	1087	3.2e-10	40.4
LXL04_023165	`PF12745.13`	HGTP_anticodon2	1106	1203	9.7e-06	26.0
LXL04_023165	`PF03129.26`	HGTP_anticodon	1110	1198	6e-09	36.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX30`	Arabidopsis thaliana	eIF-2-alpha kinase GCN2	61.075%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card