LXL04_022303 | RubberDandelionOmics

Gene overview

LXL04_022303

Reference: OH-1004 Chr: Chr04 Coordinates: 147881447-147882685 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1068 bp · LXL04_022303|LXL04_022303|OH1004|cDNA

ATGAAGTTTTCCGGGATCAAGTTTTCTTTCATGAGGTTCAGAGGTAAACATAATAAGCAGTCTCCAGCGAGATTTGCAAATAAGGACATGGATGTTAACGAGGAATACATGAACGCATTTAGAACACAATCATACTTAGACATTTGCGATAAAGTTCAAAACCACATCACATTCGATAACAAATCATCATCCATTCACCATCAATACATCCATCTATGTGACATCTTCCTCGAACCACAAACTGAAACCATAGCCAACCT...

CDS

Download CDS FASTA

1068 bp · LXL04_022303|LXL04_022303|OH1004|CDS

ATGAAGTTTTCCGGGATCAAGTTTTCTTTCATGAGGTTCAGAGGTAAACATAATAAGCAGTCTCCAGCGAGATTTGCAAATAAGGACATGGATGTTAACGAGGAATACATGAACGCATTTAGAACACAATCATACTTAGACATTTGCGATAAAGTTCAAAACCACATCACATTCGATAACAAATCATCATCCATTCACCATCAATACATCCATCTATGTGACATCTTCCTCGAACCACAAACTGAAACCATAGCCAACCT...

Protein

Download Protein FASTA

355 aa · LXL04_022303|LXL04_022303|OH1004|PROTEIN

MKFSGIKFSFMRFRGKHNKQSPARFANKDMDVNEEYMNAFRTQSYLDICDKVQNHITFDNKSSSIHHQYIHLCDIFLEPQTETIANLSKTFNLHHLLLDFFESGLQAWIICEELLESIHQVNINHHKVKRLIKLSQRVPNSKKIHEELASYSSMVNPLSDFTPSKFPKIHINHKLLLNQLTTNHTRITRKRKLLICLKKCGGYALIASYTVLAITLIVLACHGLVVTLASPGLFACFLNSIKTKKGLKTSELKRVCAQMD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022303`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022303

Location Chr04:147881447-147882685 (-)

Description Similar to At1g20180: UPF0496 protein At1g20180

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g20180`	UPF0496 protein At1g20180.	No verified direct reference in this release
`At3g49070`	UPF0496 protein At3g49070.	No verified direct reference in this release
`At3g19330`	UPF0496 protein At3g19330.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XCJ1`	UPF0496 protein 3.	No verified direct reference in this release
`Os03g0148000`	UPF0496 protein 3.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022303 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G20180

ath:AT3G19330

ath:AT3G49070

dosa:Os03g0148000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.485

Rank 1 · LXL04_022303 · OH-1004

Nucleus0.292

Rank 2 · LXL04_022303 · OH-1004

Cell membrane0.253

Rank 3 · LXL04_022303 · OH-1004

Mitochondrion0.086

Rank 4 · LXL04_022303 · OH-1004

Endoplasmic reticulum0.082

Rank 5 · LXL04_022303 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05055.18DUF67788-348 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022303	`PF05055.18`	DUF677	88	348	3.4e-10	40.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6DYE5`	Arabidopsis thaliana	UPF0496 protein At1g20180	35.185%	Swiss-Prot	moderate database homology
`Q9SMU4`	Arabidopsis thaliana	UPF0496 protein At3g49070	29.942%	Swiss-Prot	weak database homology
`Q9LT84`	Arabidopsis thaliana	UPF0496 protein At3g19330	28.291%	Swiss-Prot	weak database homology
`A2XCJ1`	Oryza sativa subsp. indica	UPF0496 protein 3	22.992%	Swiss-Prot	weak database homology
`Q10RR9`	Oryza sativa subsp. japonica	UPF0496 protein 3	22.992%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card