Gene Card
Gene overview
cDNA / CDS / Protein Sequences
747 bp · LXL04_021997|LXL04_021997|OH1004|cDNA
ATGTCGAAAGACATCAACAACATCAGTGACGGTGATAACAAAAGTAGACCTAATCGGGATTCTTCAAGAGCGACGCAACAATATGGATCCTATCATCGCAATAAAAAGGAAGACGATATGAGGCTTTGGGGAATCCTTATTTTTGGAATCATCGGAGCTACTGCCACTTATTACGCCGTTGGACAATTACGGAGAACGGCTGATTGGTTTTACACACAGTCATCATTCACTggttcttcatcttcttcttcttcccgGTC...
747 bp · LXL04_021997|LXL04_021997|OH1004|CDS
ATGTCGAAAGACATCAACAACATCAGTGACGGTGATAACAAAAGTAGACCTAATCGGGATTCTTCAAGAGCGACGCAACAATATGGATCCTATCATCGCAATAAAAAGGAAGACGATATGAGGCTTTGGGGAATCCTTATTTTTGGAATCATCGGAGCTACTGCCACTTATTACGCCGTTGGACAATTACGGAGAACGGCTGATTGGTTTTACACACAGTCATCATTCACTGGTTCTTCATCTTCTTCTTCTTCCCGGTC...
Protein
Download Protein FASTA248 aa · LXL04_021997|LXL04_021997|OH1004|PROTEIN
MSKDINNISDGDNKSRPNRDSSRATQQYGSYHRNKKEDDMRLWGILIFGIIGATATYYAVGQLRRTADWFYTQSSFTGSSSSSSSRSAFQEEARRRYARRMQEEYQEEMERVERIRRMQSVFNREKNKYRRGYERWREEEEDGAYHQRFQRDDWYWKTDTSYGRNWSNFKKPETPTVDYSLSHHYDILGLNRSRTTPYTDNEIKTAFRSKAMQYHPDQNQENKEIAEARFKEVMTSYEAIKSERKNIK
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_021997 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_021997 |
|---|---|
| Location | Chr04:142243576-142244822 (+) |
| Description | Similar to dnaJ: Chaperone protein DnaJ (Chlorobium phaeobacteroides (strain DSM 266) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006260 DNA replication Biological Process GO:0006457 protein folding Biological Process GO:0006986 response to unfolded protein Biological Process GO:0008285 negative regulation of cell population proliferation Biological Process GO:0009408 response to heat Biological Process GO:0030308 negative regulation of cell growth Biological Process GO:0031396 regulation of protein ubiquitination Biological Process GO:0031398 positive regulation of protein ubiquitination Biological Process GO:0032091 negative regulation of protein binding Biological Process GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0032781 positive regulation of ATP-dependent activity Biological Process GO:0032880 regulation of protein localization Biological Process |
| KEGG gene cross-reference | cph:Cpha266_1872 hsa:3300 mmu:56812 pla:Plav_3573 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00226.37DnaJ184-245 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_021997 | PF00226.37 | DnaJ | 184 | 245 | 5e-14 | 52.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.