LXL04_019996 | RubberDandelionOmics

Gene overview

LXL04_019996

Reference: OH-1004 Chr: Chr04 Coordinates: 46673623-46686225 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

7335 bp · LXL04_019996|LXL04_019996|OH1004|cDNA

ATGGCAGCAACACCCCAAAATGTGGAGATGGAAGCAGCAAAATTCCTGCATAAGCTTATTCAGGAATCCACTGACGAGCCCACTAAGTTGGCTACCAAACTACATGTGATTTTGCAGCATATGAGATCCAGTGGAAAGGAGAATTCAATGCCTTACCAAGTTATATCAAGGGCTATGGAGACGGTTATAAATCGCCATGGTCTTGACATTGAGGCTTTAATGTCACAAAGGCAACCGTTGACGAGTGGAAGTCAACCTGG...

CDS

Download CDS FASTA

7335 bp · LXL04_019996|LXL04_019996|OH1004|CDS

ATGGCAGCAACACCCCAAAATGTGGAGATGGAAGCAGCAAAATTCCTGCATAAGCTTATTCAGGAATCCACTGACGAGCCCACTAAGTTGGCTACCAAACTACATGTGATTTTGCAGCATATGAGATCCAGTGGAAAGGAGAATTCAATGCCTTACCAAGTTATATCAAGGGCTATGGAGACGGTTATAAATCGCCATGGTCTTGACATTGAGGCTTTAATGTCACAAAGGCAACCGTTGACGAGTGGAAGTCAACCTGG...

Protein

Download Protein FASTA

2444 aa · LXL04_019996|LXL04_019996|OH1004|PROTEIN

MAATPQNVEMEAAKFLHKLIQESTDEPTKLATKLHVILQHMRSSGKENSMPYQVISRAMETVINRHGLDIEALMSQRQPLTSGSQPGDSSLSQIAAGTSQQSAMENDSKKPLSTEDAMKIATFSSKPLHGPSTAALDMYQGSANQLNPMKSHGSNAGIPGSYESTEAMQQFNNSYDNQTAAMSMHKTLPIPGKALDHEGGFSNVMANASKTLQQGGISNNVADMGMLRNEASRDTGKLPVVQASPAGPSMPFKEHHLKQL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019996`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019996

Location Chr04:46673623-46686225 (+)

Description Similar to SYD: Chromatin structure-remodeling complex protein SYD

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28290`	Catalytic component of the chromatin structure-remodeling complex (RSC), which is involved in transcription regulation and nucleosome positioning.	No verified direct reference in this release
`At3g06010`	Probable chromatin-remodeling factor that is functionally redundant with CHR23 in root and shoot stem cell initiation, and root apical meristem (RAM) and shoot apical meristem (SAM) maintenance.	The SWI/SNF chromatin-remodeling gene AtCHR12 mediates temporary growth arrest in Arabidopsis thaliana upon perceiving environmental stress.2007 · DOI: 10.1111/j.1365-313x.2007.03185.x Mutations in two non-canonical Arabidopsis SWI2/SNF2 chromatin remodeling ATPases cause embryogenesis and stem cell maintenance defects.2012 · DOI: 10.1111/tpj.12009 Reduced seed germination in Arabidopsis over-expressing SWI/SNF2 ATPase genes.2015 · DOI: 10.1111/ppl.12231

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0144300`	Probable chromatin-remodeling factor involved in root and shoot stem cell initiation, and root apical meristem (RAM) and shoot apical meristem (SAM) maintenance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019996 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006952 defense response Biological Process

GO:0007064 mitotic sister chromatid cohesion Biological Process

GO:0009408 response to heat Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0010078 maintenance of root meristem identity Biological Process

KEGG gene cross-reference

ath:AT2G28290

ath:AT3G06010

dosa:Os05g0144300

osa:4337784

spo:2538881

spo:2542638

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.910

Rank 1 · LXL04_019996 · OH-1004

Cytoplasm0.146

Rank 2 · LXL04_019996 · OH-1004

Cell membrane0.030

Rank 3 · LXL04_019996 · OH-1004

Mitochondrion0.022

Rank 4 · LXL04_019996 · OH-1004

Endoplasmic reticulum0.018

Rank 5 · LXL04_019996 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851.22ResIII762-924 aa

PF00176.30SNF2-rel_dom766-1057 aa

PF00271.38Helicase_C1083-1173 aa

PF14619.12SnAC1290-1376 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019996	`PF04851.22`	ResIII	762	924	4.2e-14	53.5
LXL04_019996	`PF00176.30`	SNF2-rel_dom	766	1057	1.2e-91	307.5
LXL04_019996	`PF00271.38`	Helicase_C	1083	1173	1.6e-11	45.1
LXL04_019996	`PF14619.12`	SnAC	1290	1376	1.5e-12	48.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IHS2`	Arabidopsis thaliana	Chromatin structure-remodeling complex protein SYD	57.293%	Swiss-Prot	moderate database homology
`F4J9M5`	Arabidopsis thaliana	Probable ATP-dependent DNA helicase CHR12	44.582%	Swiss-Prot	weak database homology
`Q60EX7`	Oryza sativa subsp. japonica	Probable ATP-dependent DNA helicase CHR719	42.590%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card