LXL04_018433 | RubberDandelionOmics

Gene overview

LXL04_018433

Reference: OH-1004 Chr: Chr04 Coordinates: 12882975-12888584 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2781 bp · LXL04_018433|LXL04_018433|OH1004|cDNA

ATGGAACCAGAAAAGGGGAAGATGGAAGATGAAGAGATTATGGAGGTGGGGAAGCATAGGAAGCTTGGTGGGATCAAAACCATGCCTTTTATTCTGGTAGCCGGTCACTCGCCTTCTCTTACCCACCAAAACACAATCACCTTCTTCACTCAACTTCTAaccctcttcttcttcttctggaAAGCAATTGGCTTCGAGGGAAGCCTGGAATCGACGAAAGAAGAACTCAGCATTCCTCTCGTTGTTTCATCTGGATCGAC...

CDS

Download CDS FASTA

2781 bp · LXL04_018433|LXL04_018433|OH1004|CDS

ATGGAACCAGAAAAGGGGAAGATGGAAGATGAAGAGATTATGGAGGTGGGGAAGCATAGGAAGCTTGGTGGGATCAAAACCATGCCTTTTATTCTGGTAGCCGGTCACTCGCCTTCTCTTACCCACCAAAACACAATCACCTTCTTCACTCAACTTCTAACCCTCTTCTTCTTCTTCTGGAAAGCAATTGGCTTCGAGGGAAGCCTGGAATCGACGAAAGAAGAACTCAGCATTCCTCTCGTTGTTTCATCTGGATCGAC...

Protein

Download Protein FASTA

926 aa · LXL04_018433|LXL04_018433|OH1004|PROTEIN

MEPEKGKMEDEEIMEVGKHRKLGGIKTMPFILVAGHSPSLTHQNTITFFTQLLTLFFFFWKAIGFEGSLESTKEELSIPLVVSSGSTDYHPSIHVSLSLMELRATQNQASETSLGEKEEHSAIKAGLRKVKIFKEYVSIKRGKKASGEDDHVISDSRSDEGDYSNLVDSDSLEDSGDGESFEDATVRKSFSYGTLAYANYNDGSLFEDNLYYSNQKSDDGCSSKNDPTVSSSEQGMTQIPKRSILPWKKRKLNFKSPLPK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018433`
TK1151 ID	TkA08G059740
OH-1004 ID	LXL04_018433
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.200
Protein coverage (%)	TK1151 92.908 / OH-1004 62.203 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018433

Location Chr04:12882975-12888584 (-)

Description Similar to NPF3.1: Protein NRT1/ PTR FAMILY 3.1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68570`	May act as an efflux-type nitrite transporter.	A nitrite transporter associated with nitrite uptake by higher plant chloroplasts.2007 · DOI: 10.1093/pcp/pcm073
`At5g01180`	Peptide transporter.	AtPTR1 and AtPTR5 transport dipeptides in planta.2008 · DOI: 10.1104/pp.108.123844
`At3g54140`	Peptide transporter.	AtPTR1, a plasma membrane peptide transporter expressed during seed germination and in vascular tissue of Arabidopsis.2004 · DOI: 10.1111/j.1365-313x.2004.02224.x AtPTR1 and AtPTR5 transport dipeptides in planta.2008 · DOI: 10.1104/pp.108.123844
`At1g69870`	Low-affinity proton-dependent nitrate transporter.	The Arabidopsis nitrate transporter NRT1.7, expressed in phloem, is responsible for source-to-sink remobilization of nitrate.2009 · DOI: 10.1105/tpc.109.067603
`At1g62200`	Protein NRT1/ PTR FAMILY 8.5.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018433 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006857 oligopeptide transport Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010336 gibberellic acid homeostasis Biological Process

GO:0015031 protein transport Biological Process

GO:0015706 nitrate transmembrane transport Biological Process

GO:0042128 nitrate assimilation Biological Process

GO:0042938 dipeptide transport Biological Process

GO:0042939 tripeptide transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G62200

ath:AT1G68570

ath:AT1G69870

ath:AT3G54140

ath:AT5G01180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.720

Rank 1 · LXL04_018433 · OH-1004

Endoplasmic reticulum0.119

Rank 2 · LXL04_018433 · OH-1004

Lysosome / Vacuole0.081

Rank 3 · LXL04_018433 · OH-1004

Cytoplasm0.067

Rank 4 · LXL04_018433 · OH-1004

Golgi apparatus0.035

Rank 5 · LXL04_018433 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07690.22MFS_1334-849 aa

PF00854.28PTR2383-862 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018433	`PF07690.22`	MFS_1	334	849	1.4e-07	31.5
LXL04_018433	`PF00854.28`	PTR2	383	862	6.4e-85	286.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SX20`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 3.1	49.916%	Swiss-Prot	moderate database homology
`Q9LFB8`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 8.2	38.023%	Swiss-Prot	moderate database homology
`Q9M390`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 8.1	37.124%	Swiss-Prot	moderate database homology
`Q8RX77`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 2.13	37.881%	Swiss-Prot	moderate database homology
`Q93Z20`	Arabidopsis thaliana	Protein NRT1/ PTR FAMILY 8.5	35.591%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card