LXL04_017758 | RubberDandelionOmics

Gene overview

LXL04_017758

Reference: OH-1004 Chr: Chr04 Coordinates: 834752-836316 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

762 bp · LXL04_017758|LXL04_017758|OH1004|cDNA

ATGTTGGCCTACTTGAATGCTCACATCATGGCTTTCGTCTTCGGCCTCTTAGGTAATATCATAGCTTTCCTCGTTTTCTTGGCCCCGATGCCAACGTTCTATACCATTTATCGAAAAAAATCATCAGAAGGGTATCAAGCTATACCGTACATGGTCGCTCTCTTTAGTGCAGCATTGTTGTTGTACTATGCTTTTCTCAAGACAAATGCATACATGATCGTGAGCATCAATGGTTTTGGATGTGTAATTGAAATAGCTTA...

CDS

Download CDS FASTA

762 bp · LXL04_017758|LXL04_017758|OH1004|CDS

ATGTTGGCCTACTTGAATGCTCACATCATGGCTTTCGTCTTCGGCCTCTTAGGTAATATCATAGCTTTCCTCGTTTTCTTGGCCCCGATGCCAACGTTCTATACCATTTATCGAAAAAAATCATCAGAAGGGTATCAAGCTATACCGTACATGGTCGCTCTCTTTAGTGCAGCATTGTTGTTGTACTATGCTTTTCTCAAGACAAATGCATACATGATCGTGAGCATCAATGGTTTTGGATGTGTAATTGAAATAGCTTA...

Protein

Download Protein FASTA

253 aa · LXL04_017758|LXL04_017758|OH1004|PROTEIN

MLAYLNAHIMAFVFGLLGNIIAFLVFLAPMPTFYTIYRKKSSEGYQAIPYMVALFSAALLLYYAFLKTNAYMIVSINGFGCVIEIAYLAVYIFYAPKSLKISTIKLISIFNIGGLGIVMAVSILLAKGPKRVALVGWICAVINLAVFAAPLSIMRKVIRTKSVEYMPFMLSFFLTLTAIAWFFYGFFENDYYIAVPNIAGFLFGITQMILYCVYKDSKKQTGQDRSTKPNGKGTGQEEFDVEVVVYNNHQSSQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017758`
TK1151 ID	TkA08G052600
OH-1004 ID	LXL04_017758
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017758

Location Chr04:834752-836316 (+)

Description Similar to NEC1: Bidirectional sugar transporter NEC1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39060`	Mediates both low-affinity uptake and efflux of sugar across the plasma membrane (By similarity).	Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9.2014 · DOI: 10.1038/nature13082
`At5g13170`	Mediates both low-affinity uptake and efflux of sugar across the plasma membrane.	An Arabidopsis senescence-associated protein SAG29 regulates cell viability under high salinity.2011 · DOI: 10.1007/s00425-010-1293-8

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2X5B4`	Mediates both low-affinity uptake and efflux of sugar across the plasma membrane.	No verified direct reference in this release
`Os02g0513100`	Mediates both low-affinity uptake and efflux of sugar across the plasma membrane.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017758 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0008643 carbohydrate transport Biological Process

GO:0009555 pollen development Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009901 anther dehiscence Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010431 seed maturation Biological Process

GO:0015770 sucrose transport Biological Process

GO:0071215 cellular response to abscisic acid stimulus Biological Process

GO:0071446 cellular response to salicylic acid stimulus Biological Process

GO:0071470 cellular response to osmotic stress Biological Process

GO:0071836 nectar secretion Biological Process

GO:0000139 Golgi membrane Cellular Component

KEGG gene cross-reference

ath:AT2G39060

ath:AT5G13170

dosa:Os02g0513100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.709

Rank 1 · LXL04_017758 · OH-1004

Endoplasmic reticulum0.114

Rank 2 · LXL04_017758 · OH-1004

Cytoplasm0.105

Rank 3 · LXL04_017758 · OH-1004

Lysosome / Vacuole0.088

Rank 4 · LXL04_017758 · OH-1004

Golgi apparatus0.061

Rank 5 · LXL04_017758 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03083.22MtN3_slv13-97 aa

PF03083.22MtN3_slv134-219 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017758	`PF03083.22`	MtN3_slv	13	97	7.6e-51	170.8
LXL04_017758	`PF03083.22`	MtN3_slv	134	219	7.6e-51	170.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZV02`	Arabidopsis thaliana	Bidirectional sugar transporter SWEET9	62.963%	Swiss-Prot	strong database homology
`Q9FY94`	Arabidopsis thaliana	Bidirectional sugar transporter SWEET15	49.130%	Swiss-Prot	moderate database homology
`A2X5B4`	Oryza sativa subsp. indica	Bidirectional sugar transporter SWEET15	56.250%	Swiss-Prot	strong database homology
`Q6K602`	Oryza sativa subsp. japonica	Bidirectional sugar transporter SWEET15	56.250%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card