LXL04_017310 | RubberDandelionOmics

Gene overview

LXL04_017310

Reference: OH-1004 Chr: Chr03 Coordinates: 146119812-146122122 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1506 bp · LXL04_017310|LXL04_017310|OH1004|cDNA

ATGAGGGCCCGTCGTAATCCGCTGTCGAAACCCAACGCCGCCGCAACCTCCCCGGAAGAAGCCCGCGTCATCCCCAGACGAACCGTCACACCACAACAACCCAACATCGGTGGAGGACTCAGAAAAAAGGCAATCGGAGTCCGGCAATGGCTCCTCCTAGATGCCACAGGTCAGGCCCAAGTCGTCGAAGCCGGAAAATACGCCGTCATGCGGCGGACGGGCTTACCTGCGCGCGACCTCCGAATCCTCGACCCCATTCT...

CDS

Download CDS FASTA

1506 bp · LXL04_017310|LXL04_017310|OH1004|CDS

ATGAGGGCCCGTCGTAATCCGCTGTCGAAACCCAACGCCGCCGCAACCTCCCCGGAAGAAGCCCGCGTCATCCCCAGACGAACCGTCACACCACAACAACCCAACATCGGTGGAGGACTCAGAAAAAAGGCAATCGGAGTCCGGCAATGGCTCCTCCTAGATGCCACAGGTCAGGCCCAAGTCGTCGAAGCCGGAAAATACGCCGTCATGCGGCGGACGGGCTTACCTGCGCGCGACCTCCGAATCCTCGACCCCATTCT...

Protein

Download Protein FASTA

501 aa · LXL04_017310|LXL04_017310|OH1004|PROTEIN

MRARRNPLSKPNAAATSPEEARVIPRRTVTPQQPNIGGGLRKKAIGVRQWLLLDATGQAQVVEAGKYAVMRRTGLPARDLRILDPILSYPSTVLGRERAIVINLEHIKAIITAHEVLLLNSKDPSVAPFVDELQRRIQRRHLATASQEGQSDDIDSRNMYDLEDQQPKDITPESINSQEKSEEGKTEGIPSLDGGSDGLKHIRFEFISLEACLEAACSSLDMEARTLEKEAHPALDKLTTKISTLNLERVRQIKSRLVAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017310`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017310

Location Chr03:146119812-146122122 (+)

Description Similar to MRS2-3: Magnesium transporter MRS2-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19640`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0908500`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`UniProt: A2WY50`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`Os01g0869200`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`UniProt: A2WXD3`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017310 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015693 magnesium ion transport Biological Process

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0015095 magnesium ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G19640

dosa:Os01g0869200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.392

Rank 1 · LXL04_017310 · OH-1004

Plastid0.161

Rank 2 · LXL04_017310 · OH-1004

Cytoplasm0.124

Rank 3 · LXL04_017310 · OH-1004

Nucleus0.106

Rank 4 · LXL04_017310 · OH-1004

Endoplasmic reticulum0.101

Rank 5 · LXL04_017310 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22099.2MRS2-like53-140 aa

PF22099.2MRS2-like200-292 aa

PF22099.2MRS2-like373-419 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017310	`PF22099.2`	MRS2-like	53	140	5e-35	121.6
LXL04_017310	`PF22099.2`	MRS2-like	200	292	5e-35	121.6
LXL04_017310	`PF22099.2`	MRS2-like	373	419	5e-35	121.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LJN2`	Arabidopsis thaliana	Magnesium transporter MRS2-3	62.031%	Swiss-Prot	strong database homology
`Q8L4S2`	Oryza sativa subsp. japonica	Magnesium transporter MRS2-F	50.858%	Swiss-Prot	strong database homology
`A2WY50`	Oryza sativa subsp. indica	Magnesium transporter MRS2-F	50.858%	Swiss-Prot	strong database homology
`Q8S1N1`	Oryza sativa subsp. japonica	Magnesium transporter MRS2-E	42.704%	Swiss-Prot	moderate database homology
`A2WXD3`	Oryza sativa subsp. indica	Magnesium transporter MRS2-E	42.704%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card