LXL04_017029 | RubberDandelionOmics

Gene overview

LXL04_017029

Reference: OH-1004 Chr: Chr03 Coordinates: 139347745-139358323 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2213 bp · LXL04_017029|LXL04_017029|OH1004|cDNA

atgGTGACGGTGGAGAAGATCTGCAACGTCATTCATGACTTGAAGCCGGTGTTGCTGATGGTGATGGTTCAGACTACGTTTGCCGGAGTTAATGTTCTTTACAAATTAGCGGCTAATGATGGCATGAATCTTGCGATTCTTGTCGCCTATCGATTTATCTTCTCCACTGCATTCATTGTTCCACTTGCACTTTTGATTGAAAGAAACAAAAGGCCTAAATTGACATGGATGATTCTCTTTCAAGCTTGTTGTTGTGGCCT...

CDS

Download CDS FASTA

2208 bp · LXL04_017029|LXL04_017029|OH1004|CDS

ATGGTGACGGTGGAGAAGATCTGCAACGTCATTCATGACTTGAAGCCGGTGTTGCTGATGGTGATGGTTCAGACTACGTTTGCCGGAGTTAATGTTCTTTACAAATTAGCGGCTAATGATGGCATGAATCTTGCGATTCTTGTCGCCTATCGATTTATCTTCTCCACTGCATTCATTGTTCCACTTGCACTTTTGATTGAAAGAAACAAAAGGCCTAAATTGACATGGATGATTCTCTTTCAAGCTTGTTGTTGTGGCCT...

Protein

Download Protein FASTA

735 aa · LXL04_017029|LXL04_017029|OH1004|PROTEIN

MVTVEKICNVIHDLKPVLLMVMVQTTFAGVNVLYKLAANDGMNLAILVAYRFIFSTAFIVPLALLIERNKRPKLTWMILFQACCCGLFGGSLAQNFYIKALSLTSATFAAATTNLIPAITFVLAVCFRMERLGWKTSPGAAKVLGTVFGVGGAMLLTFYKGIDLHLWKTNVDLLHGQNNGLGPQHSSHDRVMGSLFAIGSCISYSIWLIIQTNMVKHYPCPYSVTALTSALGAIQAVGFGLCTERHWADWKLGWNIRLLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017029`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017029

Location Chr03:139347745-139358323 (-)

Description Similar to At1g25270: WAT1-related protein At1g25270

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g25270`	WAT1-related protein At1g25270.	No verified direct reference in this release
`At1g68170`	WAT1-related protein At1g68170.	No verified direct reference in this release
`At4g08300`	WAT1-related protein At4g08300.	No verified direct reference in this release
`At5g07050`	WAT1-related protein At5g07050.	No verified direct reference in this release
`At1g09380`	WAT1-related protein At1g09380.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017029 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G25270

ath:AT1G68170

ath:AT4G08300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.680

Rank 1 · LXL04_017029 · OH-1004

Endoplasmic reticulum0.141

Rank 2 · LXL04_017029 · OH-1004

Lysosome / Vacuole0.105

Rank 3 · LXL04_017029 · OH-1004

Cytoplasm0.066

Rank 4 · LXL04_017029 · OH-1004

Golgi apparatus0.045

Rank 5 · LXL04_017029 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00892.27EamA16-157 aa

PF00892.27EamA192-330 aa

PF00892.27EamA398-489 aa

PF00892.27EamA530-667 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017029	`PF00892.27`	EamA	16	157	1.1e-45	155.9
LXL04_017029	`PF00892.27`	EamA	192	330	1.1e-45	155.9
LXL04_017029	`PF00892.27`	EamA	398	489	1.1e-45	155.9
LXL04_017029	`PF00892.27`	EamA	530	667	1.1e-45	155.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q4PT23`	Arabidopsis thaliana	WAT1-related protein At1g25270	42.683%	Swiss-Prot	weak database homology
`F4HVM3`	Arabidopsis thaliana	WAT1-related protein At1g68170	43.119%	Swiss-Prot	weak database homology
`Q501F8`	Arabidopsis thaliana	WAT1-related protein At4g08300	35.795%	Swiss-Prot	weak database homology
`Q9FL41`	Arabidopsis thaliana	WAT1-related protein At5g07050	38.268%	Swiss-Prot	weak database homology
`Q8GXB4`	Arabidopsis thaliana	WAT1-related protein At1g09380	37.135%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card